Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219947304:

Variant ID: vg1219947304 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19947304
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATCTAGCATAATAATCTACTTGTTTGTTTCAGTTACTCCTTGTCAGGGTTACGGGTTCGGCATACCCTTTACCCTTCGATATACGTTACATATCGATATG[G/T]
CATACCCACGCGCACGCGGATATTTCCTGCATATTCTAAGGAAACCTTTCACGAAATCTACAGATGGGAAGAATCCTACTCGGACAGAACTGGGTCGTTG

Reverse complement sequence

CAACGACCCAGTTCTGTCCGAGTAGGATTCTTCCCATCTGTAGATTTCGTGAAAGGTTTCCTTAGAATATGCAGGAAATATCCGCGTGCGCGTGGGTATG[C/A]
CATATCGATATGTAACGTATATCGAAGGGTAAAGGGTATGCCGAACCCGTAACCCTGACAAGGAGTAACTGAAACAAACAAGTAGATTATTATGCTAGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.40%	21.20%	2.39%	0.00%	NA
All Indica	2759	97.70%	1.90%	0.40%	0.00%	NA
All Japonica	1512	38.70%	55.00%	6.28%	0.00%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.70%	1.20%	0.11%	0.00%	NA
Indica Intermediate	786	95.20%	3.60%	1.27%	0.00%	NA
Temperate Japonica	767	63.20%	28.40%	8.34%	0.00%	NA
Tropical Japonica	504	7.50%	89.10%	3.37%	0.00%	NA
Japonica Intermediate	241	25.70%	68.50%	5.81%	0.00%	NA
VI/Aromatic	96	16.70%	81.20%	2.08%	0.00%	NA
Intermediate	90	60.00%	35.60%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219947304	G -> T	LOC_Os12g33010.1	upstream_gene_variant ; 333.0bp to feature; MODIFIER	silent_mutation	Average:69.986; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg1219947304	G -> T	LOC_Os12g33020.1	upstream_gene_variant ; 784.0bp to feature; MODIFIER	silent_mutation	Average:69.986; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg1219947304	G -> T	LOC_Os12g33000.1	downstream_gene_variant ; 4297.0bp to feature; MODIFIER	silent_mutation	Average:69.986; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N
vg1219947304	G -> T	LOC_Os12g33010-LOC_Os12g33020	intergenic_region ; MODIFIER	silent_mutation	Average:69.986; most accessible tissue: Minghui63 flag leaf, score: 81.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219947304	NA	5.73E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	5.20E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	1.17E-14	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	6.26E-21	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	3.33E-12	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	4.52E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	1.58E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	3.66E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	5.61E-11	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.29E-06	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	6.30E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	4.49E-10	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.39E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	6.16E-09	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	9.06E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.94E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	1.90E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	2.93E-06	2.89E-15	mr1486_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	1.29E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	9.03E-08	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	1.80E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.07E-13	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	5.02E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	4.48E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.01E-06	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	8.48E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.82E-08	mr1805_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219947304	NA	2.44E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251