\
| Variant ID: vg1219947105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19947105 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.01, others allele: 0.00, population size: 80. )
GTTAGTGAACTAGGGTTTCTTGCGGCGGTGGAGAAGGCAAAGAGCGCTGGTAGGCGGTGTGTGTTCAACAGGGTTGGCGGACTTCAAAATGGGCTCCCAA[A/T]
ATTCCTTTAAATAGACACACTACCGACGGTGCGAATTATACTAATCTGGCTATAGAGGAGATTATTGGATTATACTAATCTGGCTATAGATTATAATAAT
ATTATTATAATCTATAGCCAGATTAGTATAATCCAATAATCTCCTCTATAGCCAGATTAGTATAATTCGCACCGTCGGTAGTGTGTCTATTTAAAGGAAT[T/A]
TTGGGAGCCCATTTTGAAGTCCGCCAACCCTGTTGAACACACACCGCCTACCAGCGCTCTTTGCCTTCTCCACCGCCGCAAGAAACCCTAGTTCACTAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 3.80% | 0.76% | 1.78% | NA |
| All Indica | 2759 | 91.00% | 5.10% | 1.16% | 2.68% | NA |
| All Japonica | 1512 | 99.00% | 0.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 88.50% | 7.40% | 0.37% | 3.72% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.50% | 12.00% | 1.29% | 2.15% | NA |
| Indica III | 913 | 89.40% | 5.30% | 1.64% | 3.72% | NA |
| Indica Intermediate | 786 | 90.20% | 4.60% | 1.40% | 3.82% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219947105 | A -> DEL | N | N | silent_mutation | Average:73.521; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg1219947105 | A -> T | LOC_Os12g33010.1 | upstream_gene_variant ; 134.0bp to feature; MODIFIER | silent_mutation | Average:73.521; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg1219947105 | A -> T | LOC_Os12g33020.1 | upstream_gene_variant ; 983.0bp to feature; MODIFIER | silent_mutation | Average:73.521; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg1219947105 | A -> T | LOC_Os12g33000.1 | downstream_gene_variant ; 4098.0bp to feature; MODIFIER | silent_mutation | Average:73.521; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| vg1219947105 | A -> T | LOC_Os12g33010-LOC_Os12g33020 | intergenic_region ; MODIFIER | silent_mutation | Average:73.521; most accessible tissue: Minghui63 flag leaf, score: 83.197 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219947105 | NA | 3.01E-06 | mr1377 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219947105 | 1.08E-06 | 1.08E-06 | mr1377 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |