\
| Variant ID: vg1219937863 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19937863 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACCGCGGGAGGTATTGGCTATCGATGACGTTGGCACGTCAGCGCACGCCAACGCAGAAGCGGCAAATCAATCGACTACACCAGCCCAACACATCAGGGC[C/T]
GTTCAAGCTATACTGAGGGAAACTCCTTACGATCCCGTTCTGAACGATGACCTCGAGTGTTGGACAGAACGACTACGGGAATCTGTGACTAACCTCAGCA
TGCTGAGGTTAGTCACAGATTCCCGTAGTCGTTCTGTCCAACACTCGAGGTCATCGTTCAGAACGGGATCGTAAGGAGTTTCCCTCAGTATAGCTTGAAC[G/A]
GCCCTGATGTGTTGGGCTGGTGTAGTCGATTGATTTGCCGCTTCTGCGTTGGCGTGCGCTGACGTGCCAACGTCATCGATAGCCAATACCTCCCGCGGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.70% | 21.50% | 1.74% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 1.80% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 39.40% | 56.20% | 4.50% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 3.80% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 64.10% | 29.70% | 6.13% | 0.00% | NA |
| Tropical Japonica | 504 | 8.30% | 89.10% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 25.30% | 71.40% | 3.32% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 35.60% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219937863 | C -> T | LOC_Os12g33000.1 | synonymous_variant ; p.Ala301Ala; LOW | synonymous_codon | Average:66.02; most accessible tissue: Minghui63 flag leaf, score: 80.786 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219937863 | NA | 3.00E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 1.22E-09 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 1.98E-14 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 2.23E-19 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 3.32E-12 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 5.71E-08 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 3.51E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 6.98E-12 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 1.30E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 1.86E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 5.31E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 6.33E-12 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 7.24E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 2.78E-09 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 1.28E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | 9.65E-07 | NA | mr1486_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | 3.44E-06 | 2.74E-14 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 2.29E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 7.58E-06 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 3.56E-08 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219937863 | NA | 4.01E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |