\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219910283:

Variant ID: vg1219910283 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 19910283
Reference Allele: TAlternative Allele: C,TC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.82, C: 0.17, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


AACATGATTAATACTTTATGCGTGACTTATCTTTTTAATTTTTTTCATATTTTTTTAAAATAAGACAGATGGTCAAACGTTGGACACGGAAATCAAGGTT[T/C,TC]
GTCTTTTTTTTTTTGGACGGAGGAAGTATACGTGAAGTGGTACCAGATTTGAGACCCATTAACAGAAGGCGATTTGAGTGGACTCACGCATGCGGACGTG

Reverse complement sequence

CACGTCCGCATGCGTGAGTCCACTCAAATCGCCTTCTGTTAATGGGTCTCAAATCTGGTACCACTTCACGTATACTTCCTCCGTCCAAAAAAAAAAAGAC[A/G,GA]
AACCTTGATTTCCGTGTCCAACGTTTGACCATCTGTCTTATTTTAAAAAAATATGAAAAAAATTAAAAAGATAAGTCACGCATAAAGTATTAATCATGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 39.70% 1.82% 1.97% TC: 0.80%
All Indica  2759 87.10% 6.80% 2.75% 3.26% TC: 0.14%
All Japonica  1512 2.80% 97.00% 0.13% 0.13% NA
Aus  269 58.70% 27.50% 1.86% 0.00% TC: 11.90%
Indica I  595 90.80% 3.00% 5.04% 1.18% NA
Indica II  465 80.90% 8.00% 3.87% 7.31% NA
Indica III  913 93.30% 4.80% 0.55% 1.31% NA
Indica Intermediate  786 80.70% 11.20% 2.93% 4.71% TC: 0.51%
Temperate Japonica  767 1.30% 98.60% 0.13% 0.00% NA
Tropical Japonica  504 4.60% 94.80% 0.20% 0.40% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 28.90% 64.40% 3.33% 1.11% TC: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219910283 T -> C LOC_Os12g32950.1 upstream_gene_variant ; 3951.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> C LOC_Os12g32960.1 downstream_gene_variant ; 1739.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> C LOC_Os12g32970.1 downstream_gene_variant ; 300.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> C LOC_Os12g32980.1 downstream_gene_variant ; 4024.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> C LOC_Os12g32960-LOC_Os12g32970 intergenic_region ; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> DEL N N silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> TC LOC_Os12g32950.1 upstream_gene_variant ; 3952.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> TC LOC_Os12g32960.1 downstream_gene_variant ; 1740.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> TC LOC_Os12g32970.1 downstream_gene_variant ; 299.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> TC LOC_Os12g32980.1 downstream_gene_variant ; 4023.0bp to feature; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N
vg1219910283 T -> TC LOC_Os12g32960-LOC_Os12g32970 intergenic_region ; MODIFIER silent_mutation Average:79.744; most accessible tissue: Minghui63 root, score: 95.576 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219910283 T C -0.05 -0.02 -0.02 -0.03 -0.06 -0.08
vg1219910283 T TC -0.21 0.29 0.3 0.03 0.06 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219910283 NA 2.30E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 9.00E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 5.24E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 9.12E-28 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 6.23E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 2.51E-39 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.12E-18 mr1148_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.10E-49 mr1154_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 7.44E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.62E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 7.26E-33 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 5.28E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.60E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 3.62E-08 NA mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.42E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 8.88E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 5.12E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 3.98E-11 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.41E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219910283 NA 1.82E-21 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251