Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219908853:

Variant ID: vg1219908853 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19908853
Reference Allele: A	Alternative Allele: C
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TTACGAGTGTTTTAGCTTTCAAGTTTGCTAAAAATGCAGGAGGACAAGTTGGCATTGGGATGAAGTTATAGGGTGGGTTTGGTTCGTTAACATACTAAAT[A/C]
TTTGATAGTATCAAATTCTTGATAAGTATTGGTATGTACTATCATTTCATTTCTTTTAAGTAGGATAGAGTTGTAGTACGAATGTTTGGATTGGCAGAGG

Reverse complement sequence

CCTCTGCCAATCCAAACATTCGTACTACAACTCTATCCTACTTAAAAGAAATGAAATGATAGTACATACCAATACTTATCAAGAATTTGATACTATCAAA[T/G]
ATTTAGTATGTTAACGAACCAAACCCACCCTATAACTTCATCCCAATGCCAACTTGTCCTCCTGCATTTTTAGCAAACTTGAAAGCTAAAACACTCGTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	11.40%	1.78%	0.00%	NA
All Indica	2759	98.80%	0.90%	0.29%	0.00%	NA
All Japonica	1512	62.20%	33.00%	4.76%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	0.50%	0.50%	0.00%	NA
Indica II	465	97.40%	2.40%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.30%	1.10%	0.51%	0.00%	NA
Temperate Japonica	767	34.20%	59.20%	6.65%	0.00%	NA
Tropical Japonica	504	96.00%	2.20%	1.79%	0.00%	NA
Japonica Intermediate	241	80.90%	14.10%	4.98%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	16.70%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219908853	A -> C	LOC_Os12g32950.1	upstream_gene_variant ; 2521.0bp to feature; MODIFIER	silent_mutation	Average:51.58; most accessible tissue: Callus, score: 74.802	N	N	N	N
vg1219908853	A -> C	LOC_Os12g32960.1	downstream_gene_variant ; 309.0bp to feature; MODIFIER	silent_mutation	Average:51.58; most accessible tissue: Callus, score: 74.802	N	N	N	N
vg1219908853	A -> C	LOC_Os12g32970.1	downstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:51.58; most accessible tissue: Callus, score: 74.802	N	N	N	N
vg1219908853	A -> C	LOC_Os12g32960-LOC_Os12g32970	intergenic_region ; MODIFIER	silent_mutation	Average:51.58; most accessible tissue: Callus, score: 74.802	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219908853	NA	2.06E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	6.63E-21	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	7.29E-11	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	2.04E-09	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	4.48E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	3.56E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	6.73E-12	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	3.13E-07	NA	mr1588_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	6.25E-07	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853	NA	6.47E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251