\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219908853:

Variant ID: vg1219908853 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19908853
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TTACGAGTGTTTTAGCTTTCAAGTTTGCTAAAAATGCAGGAGGACAAGTTGGCATTGGGATGAAGTTATAGGGTGGGTTTGGTTCGTTAACATACTAAAT[A/C]
TTTGATAGTATCAAATTCTTGATAAGTATTGGTATGTACTATCATTTCATTTCTTTTAAGTAGGATAGAGTTGTAGTACGAATGTTTGGATTGGCAGAGG

Reverse complement sequence

CCTCTGCCAATCCAAACATTCGTACTACAACTCTATCCTACTTAAAAGAAATGAAATGATAGTACATACCAATACTTATCAAGAATTTGATACTATCAAA[T/G]
ATTTAGTATGTTAACGAACCAAACCCACCCTATAACTTCATCCCAATGCCAACTTGTCCTCCTGCATTTTTAGCAAACTTGAAAGCTAAAACACTCGTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 11.40% 1.78% 0.00% NA
All Indica  2759 98.80% 0.90% 0.29% 0.00% NA
All Japonica  1512 62.20% 33.00% 4.76% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 97.40% 2.40% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.10% 0.51% 0.00% NA
Temperate Japonica  767 34.20% 59.20% 6.65% 0.00% NA
Tropical Japonica  504 96.00% 2.20% 1.79% 0.00% NA
Japonica Intermediate  241 80.90% 14.10% 4.98% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 16.70% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219908853 A -> C LOC_Os12g32950.1 upstream_gene_variant ; 2521.0bp to feature; MODIFIER silent_mutation Average:51.58; most accessible tissue: Callus, score: 74.802 N N N N
vg1219908853 A -> C LOC_Os12g32960.1 downstream_gene_variant ; 309.0bp to feature; MODIFIER silent_mutation Average:51.58; most accessible tissue: Callus, score: 74.802 N N N N
vg1219908853 A -> C LOC_Os12g32970.1 downstream_gene_variant ; 1730.0bp to feature; MODIFIER silent_mutation Average:51.58; most accessible tissue: Callus, score: 74.802 N N N N
vg1219908853 A -> C LOC_Os12g32960-LOC_Os12g32970 intergenic_region ; MODIFIER silent_mutation Average:51.58; most accessible tissue: Callus, score: 74.802 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219908853 NA 2.06E-06 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 6.63E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 7.29E-11 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 2.04E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 4.48E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 3.56E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 6.73E-12 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 3.13E-07 NA mr1588_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 6.25E-07 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219908853 NA 6.47E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251