\
| Variant ID: vg1219908853 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19908853 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 254. )
TTACGAGTGTTTTAGCTTTCAAGTTTGCTAAAAATGCAGGAGGACAAGTTGGCATTGGGATGAAGTTATAGGGTGGGTTTGGTTCGTTAACATACTAAAT[A/C]
TTTGATAGTATCAAATTCTTGATAAGTATTGGTATGTACTATCATTTCATTTCTTTTAAGTAGGATAGAGTTGTAGTACGAATGTTTGGATTGGCAGAGG
CCTCTGCCAATCCAAACATTCGTACTACAACTCTATCCTACTTAAAAGAAATGAAATGATAGTACATACCAATACTTATCAAGAATTTGATACTATCAAA[T/G]
ATTTAGTATGTTAACGAACCAAACCCACCCTATAACTTCATCCCAATGCCAACTTGTCCTCCTGCATTTTTAGCAAACTTGAAAGCTAAAACACTCGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.80% | 11.40% | 1.78% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 0.90% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 62.20% | 33.00% | 4.76% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.10% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 34.20% | 59.20% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 2.20% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 14.10% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 16.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219908853 | A -> C | LOC_Os12g32950.1 | upstream_gene_variant ; 2521.0bp to feature; MODIFIER | silent_mutation | Average:51.58; most accessible tissue: Callus, score: 74.802 | N | N | N | N |
| vg1219908853 | A -> C | LOC_Os12g32960.1 | downstream_gene_variant ; 309.0bp to feature; MODIFIER | silent_mutation | Average:51.58; most accessible tissue: Callus, score: 74.802 | N | N | N | N |
| vg1219908853 | A -> C | LOC_Os12g32970.1 | downstream_gene_variant ; 1730.0bp to feature; MODIFIER | silent_mutation | Average:51.58; most accessible tissue: Callus, score: 74.802 | N | N | N | N |
| vg1219908853 | A -> C | LOC_Os12g32960-LOC_Os12g32970 | intergenic_region ; MODIFIER | silent_mutation | Average:51.58; most accessible tissue: Callus, score: 74.802 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219908853 | NA | 2.06E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 6.63E-21 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 7.29E-11 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 2.04E-09 | mr1011_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 4.48E-07 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 3.56E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 6.73E-12 | mr1486_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | 3.13E-07 | NA | mr1588_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 6.25E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219908853 | NA | 6.47E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |