\
| Variant ID: vg1219850678 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19850678 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 89. )
TCCAACGCCACCGGCTTTCCCTCCGCGCGGCGTAGAGTGCTTAAGAGTTTCTCCACCTAATTATGAAGTAGTAAAATACGTGAGATTTGCTCTGGTCTAG[C/T]
AAAAAGGCATCTCGAGGTACTAGTACCTAACAGTACTAAATCGTTTCTAATCGTTAGATCTACCTAAACAGGATGGACATTATTAGATCCAACGATCAAA
TTTGATCGTTGGATCTAATAATGTCCATCCTGTTTAGGTAGATCTAACGATTAGAAACGATTTAGTACTGTTAGGTACTAGTACCTCGAGATGCCTTTTT[G/A]
CTAGACCAGAGCAAATCTCACGTATTTTACTACTTCATAATTAGGTGGAGAAACTCTTAAGCACTCTACGCCGCGCGGAGGGAAAGCCGGTGGCGTTGGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 38.30% | 1.74% | 4.17% | NA |
| All Indica | 2759 | 87.50% | 12.10% | 0.25% | 0.07% | NA |
| All Japonica | 1512 | 3.80% | 78.90% | 4.56% | 12.76% | NA |
| Aus | 269 | 49.40% | 50.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 85.70% | 13.80% | 0.34% | 0.17% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.00% | 0.22% | NA |
| Indica III | 913 | 89.90% | 9.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 81.30% | 18.30% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 3.10% | 69.00% | 7.43% | 20.47% | NA |
| Tropical Japonica | 504 | 4.20% | 95.40% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 5.00% | 75.90% | 4.56% | 14.52% | NA |
| VI/Aromatic | 96 | 7.30% | 91.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 30.00% | 63.30% | 4.44% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219850678 | C -> DEL | N | N | silent_mutation | Average:63.145; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg1219850678 | C -> T | LOC_Os12g32840.1 | downstream_gene_variant ; 2348.0bp to feature; MODIFIER | silent_mutation | Average:63.145; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| vg1219850678 | C -> T | LOC_Os12g32850.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.145; most accessible tissue: Callus, score: 84.604 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219850678 | NA | 5.20E-12 | mr1084_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.24E-12 | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 6.67E-10 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.35E-10 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 6.30E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | 1.80E-06 | 4.62E-07 | mr1209_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 4.37E-10 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.77E-06 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 4.70E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.39E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 5.13E-09 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.81E-09 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | 3.82E-06 | NA | mr1381_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | 1.00E-06 | NA | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.74E-07 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.41E-09 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.68E-07 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.16E-07 | mr1420_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.09E-09 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 7.94E-15 | mr1454_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 3.45E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 5.16E-06 | mr1467_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 4.36E-10 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.26E-06 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | 4.75E-06 | 1.49E-13 | mr1506_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.13E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 3.90E-09 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 3.44E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 7.30E-13 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.98E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 5.32E-09 | mr1681_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.45E-11 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.20E-07 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.24E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.42E-13 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | 7.82E-06 | 2.58E-08 | mr1781_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 1.77E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 8.96E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 2.36E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | NA | 8.38E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219850678 | 5.57E-06 | 1.40E-09 | mr1992_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |