\
| Variant ID: vg1219845789 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19845789 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, C: 0.20, others allele: 0.00, population size: 191. )
TTAGGAATTTAGGGTTCATGTGCACCCCCAACATAATATAGCTTCGCCACTGGATTCAGCAGCATTGATGGTATATTTGTATCGAAAAATTTACATCCAA[G/C,T]
ATATTTATGAGAAAAAAAAAATGAACAATATATTTTTCAAATTTAATCCCTCCATGCACAGCGACACGCTATTTGCACCGTTTTCACCTTTGGCCGACTA
TAGTCGGCCAAAGGTGAAAACGGTGCAAATAGCGTGTCGCTGTGCATGGAGGGATTAAATTTGAAAAATATATTGTTCATTTTTTTTTTCTCATAAATAT[C/G,A]
TTGGATGTAAATTTTTCGATACAAATATACCATCAATGCTGCTGAATCCAGTGGCGAAGCTATATTATGTTGGGGGTGCACATGAACCCTAAATTCCTAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.20% | 42.40% | 0.13% | 0.23% | T: 0.13% |
| All Indica | 2759 | 39.30% | 60.10% | 0.18% | 0.40% | T: 0.04% |
| All Japonica | 1512 | 96.80% | 3.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 3.00% | 95.90% | 0.00% | 0.00% | T: 1.12% |
| Indica I | 595 | 62.90% | 36.30% | 0.34% | 0.50% | NA |
| Indica II | 465 | 6.90% | 92.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 46.70% | 52.70% | 0.22% | 0.33% | T: 0.11% |
| Indica Intermediate | 786 | 32.20% | 67.20% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.00% | 4.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 85.40% | 13.50% | 0.00% | 0.00% | T: 1.04% |
| Intermediate | 90 | 70.00% | 28.90% | 0.00% | 0.00% | T: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219845789 | G -> C | LOC_Os12g32840.1 | upstream_gene_variant ; 1872.0bp to feature; MODIFIER | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| vg1219845789 | G -> C | LOC_Os12g32850.1 | downstream_gene_variant ; 3018.0bp to feature; MODIFIER | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| vg1219845789 | G -> C | LOC_Os12g32820-LOC_Os12g32840 | intergenic_region ; MODIFIER | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| vg1219845789 | G -> DEL | N | N | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| vg1219845789 | G -> T | LOC_Os12g32840.1 | upstream_gene_variant ; 1872.0bp to feature; MODIFIER | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| vg1219845789 | G -> T | LOC_Os12g32850.1 | downstream_gene_variant ; 3018.0bp to feature; MODIFIER | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| vg1219845789 | G -> T | LOC_Os12g32820-LOC_Os12g32840 | intergenic_region ; MODIFIER | silent_mutation | Average:43.277; most accessible tissue: Callus, score: 70.101 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219845789 | NA | 2.46E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 7.84E-14 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 6.96E-27 | mr1557 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 9.80E-10 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 3.35E-06 | mr1598 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 1.63E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 4.98E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 3.64E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 1.63E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 3.25E-07 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 2.57E-11 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 2.13E-22 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 6.03E-09 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219845789 | NA | 7.99E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |