Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219845789:

Variant ID: vg1219845789 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19845789
Reference Allele: G	Alternative Allele: C,T
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, C: 0.20, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGAATTTAGGGTTCATGTGCACCCCCAACATAATATAGCTTCGCCACTGGATTCAGCAGCATTGATGGTATATTTGTATCGAAAAATTTACATCCAA[G/C,T]
ATATTTATGAGAAAAAAAAAATGAACAATATATTTTTCAAATTTAATCCCTCCATGCACAGCGACACGCTATTTGCACCGTTTTCACCTTTGGCCGACTA

Reverse complement sequence

TAGTCGGCCAAAGGTGAAAACGGTGCAAATAGCGTGTCGCTGTGCATGGAGGGATTAAATTTGAAAAATATATTGTTCATTTTTTTTTTCTCATAAATAT[C/G,A]
TTGGATGTAAATTTTTCGATACAAATATACCATCAATGCTGCTGAATCCAGTGGCGAAGCTATATTATGTTGGGGGTGCACATGAACCCTAAATTCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.20%	42.40%	0.13%	0.23%	T: 0.13%
All Indica	2759	39.30%	60.10%	0.18%	0.40%	T: 0.04%
All Japonica	1512	96.80%	3.20%	0.07%	0.00%	NA
Aus	269	3.00%	95.90%	0.00%	0.00%	T: 1.12%
Indica I	595	62.90%	36.30%	0.34%	0.50%	NA
Indica II	465	6.90%	92.90%	0.22%	0.00%	NA
Indica III	913	46.70%	52.70%	0.22%	0.33%	T: 0.11%
Indica Intermediate	786	32.20%	67.20%	0.00%	0.64%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	6.20%	0.41%	0.00%	NA
VI/Aromatic	96	85.40%	13.50%	0.00%	0.00%	T: 1.04%
Intermediate	90	70.00%	28.90%	0.00%	0.00%	T: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219845789	G -> C	LOC_Os12g32840.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N
vg1219845789	G -> C	LOC_Os12g32850.1	downstream_gene_variant ; 3018.0bp to feature; MODIFIER	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N
vg1219845789	G -> C	LOC_Os12g32820-LOC_Os12g32840	intergenic_region ; MODIFIER	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N
vg1219845789	G -> DEL	N	N	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N
vg1219845789	G -> T	LOC_Os12g32840.1	upstream_gene_variant ; 1872.0bp to feature; MODIFIER	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N
vg1219845789	G -> T	LOC_Os12g32850.1	downstream_gene_variant ; 3018.0bp to feature; MODIFIER	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N
vg1219845789	G -> T	LOC_Os12g32820-LOC_Os12g32840	intergenic_region ; MODIFIER	silent_mutation	Average:43.277; most accessible tissue: Callus, score: 70.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219845789	NA	2.46E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	7.84E-14	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	6.96E-27	mr1557	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	9.80E-10	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	3.35E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	1.63E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	4.98E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	3.64E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	1.63E-11	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	3.25E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	2.57E-11	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	2.13E-22	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	6.03E-09	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789	NA	7.99E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251