\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219845789:

Variant ID: vg1219845789 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19845789
Reference Allele: GAlternative Allele: C,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, C: 0.20, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGAATTTAGGGTTCATGTGCACCCCCAACATAATATAGCTTCGCCACTGGATTCAGCAGCATTGATGGTATATTTGTATCGAAAAATTTACATCCAA[G/C,T]
ATATTTATGAGAAAAAAAAAATGAACAATATATTTTTCAAATTTAATCCCTCCATGCACAGCGACACGCTATTTGCACCGTTTTCACCTTTGGCCGACTA

Reverse complement sequence

TAGTCGGCCAAAGGTGAAAACGGTGCAAATAGCGTGTCGCTGTGCATGGAGGGATTAAATTTGAAAAATATATTGTTCATTTTTTTTTTCTCATAAATAT[C/G,A]
TTGGATGTAAATTTTTCGATACAAATATACCATCAATGCTGCTGAATCCAGTGGCGAAGCTATATTATGTTGGGGGTGCACATGAACCCTAAATTCCTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 42.40% 0.13% 0.23% T: 0.13%
All Indica  2759 39.30% 60.10% 0.18% 0.40% T: 0.04%
All Japonica  1512 96.80% 3.20% 0.07% 0.00% NA
Aus  269 3.00% 95.90% 0.00% 0.00% T: 1.12%
Indica I  595 62.90% 36.30% 0.34% 0.50% NA
Indica II  465 6.90% 92.90% 0.22% 0.00% NA
Indica III  913 46.70% 52.70% 0.22% 0.33% T: 0.11%
Indica Intermediate  786 32.20% 67.20% 0.00% 0.64% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 96.00% 4.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 85.40% 13.50% 0.00% 0.00% T: 1.04%
Intermediate  90 70.00% 28.90% 0.00% 0.00% T: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219845789 G -> C LOC_Os12g32840.1 upstream_gene_variant ; 1872.0bp to feature; MODIFIER silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N
vg1219845789 G -> C LOC_Os12g32850.1 downstream_gene_variant ; 3018.0bp to feature; MODIFIER silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N
vg1219845789 G -> C LOC_Os12g32820-LOC_Os12g32840 intergenic_region ; MODIFIER silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N
vg1219845789 G -> DEL N N silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N
vg1219845789 G -> T LOC_Os12g32840.1 upstream_gene_variant ; 1872.0bp to feature; MODIFIER silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N
vg1219845789 G -> T LOC_Os12g32850.1 downstream_gene_variant ; 3018.0bp to feature; MODIFIER silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N
vg1219845789 G -> T LOC_Os12g32820-LOC_Os12g32840 intergenic_region ; MODIFIER silent_mutation Average:43.277; most accessible tissue: Callus, score: 70.101 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219845789 NA 2.46E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 7.84E-14 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 6.96E-27 mr1557 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 9.80E-10 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 3.35E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 1.63E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 4.98E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 3.64E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 1.63E-11 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 3.25E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 2.57E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 2.13E-22 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 6.03E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219845789 NA 7.99E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251