Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219821320:

Variant ID: vg1219821320 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19821320
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.30, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CACGGATCACAAGAGTTTGAAGTATATCTTCACCCAGCCAGATCTGAACATGAGGCAGCAGAGATGGTTGGAACTGATTAAGGATTATGACATGGGAATT[T/C,G]
ATTATCACCCAGGAAAGGCTAATGTTGTAGCAGATGCTCTTAGCAGGAAAGGCTATTGCAATGCTACGGAAGGACGACAGTTGCCGTGGGAATTATGCAA

Reverse complement sequence

TTGCATAATTCCCACGGCAACTGTCGTCCTTCCGTAGCATTGCAATAGCCTTTCCTGCTAAGAGCATCTGCTACAACATTAGCCTTTCCTGGGTGATAAT[A/G,C]
AATTCCCATGTCATAATCCTTAATCAGTTCCAACCATCTCTGCTGCCTCATGTTCAGATCTGGCTGGGTGAAGATATACTTCAAACTCTTGTGATCCGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.80%	7.80%	52.69%	3.66%	G: 0.11%
All Indica	2759	8.50%	9.60%	80.54%	1.34%	G: 0.07%
All Japonica	1512	86.30%	0.30%	5.22%	8.13%	NA
Aus	269	5.60%	32.30%	59.85%	2.23%	NA
Indica I	595	7.70%	3.90%	85.21%	3.19%	NA
Indica II	465	6.00%	4.30%	88.82%	0.65%	G: 0.22%
Indica III	913	8.30%	14.00%	77.33%	0.33%	NA
Indica Intermediate	786	10.70%	11.80%	75.83%	1.53%	G: 0.13%
Temperate Japonica	767	82.70%	0.10%	4.04%	13.17%	NA
Tropical Japonica	504	95.80%	0.40%	3.37%	0.40%	NA
Japonica Intermediate	241	78.00%	0.80%	12.86%	8.30%	NA
VI/Aromatic	96	85.40%	6.20%	5.21%	3.12%	NA
Intermediate	90	61.10%	5.60%	25.56%	4.44%	G: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219821320	T -> C	LOC_Os12g32800.1	missense_variant ; p.Tyr1167His; MODERATE	nonsynonymous_codon ; Y1167H	Average:14.622; most accessible tissue: Callus, score: 20.831	possibly damaging	-1.781	TOLERATED	1.00
vg1219821320	T -> DEL	LOC_Os12g32800.1	N	frameshift_variant	Average:14.622; most accessible tissue: Callus, score: 20.831	N	N	N	N
vg1219821320	T -> G	LOC_Os12g32800.1	missense_variant ; p.Tyr1167Asp; MODERATE	nonsynonymous_codon ; Y1167D	Average:14.622; most accessible tissue: Callus, score: 20.831	benign	-0.015	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219821320	NA	3.18E-12	mr1070	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.56E-10	mr1097	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	6.11E-13	mr1128	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	4.57E-07	1.30E-47	mr1152	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	3.79E-22	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	3.65E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	6.42E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.11E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	4.02E-15	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.11E-23	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	6.58E-12	mr1386	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.25E-27	mr1414	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	7.55E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.77E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	4.02E-15	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.82E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	3.03E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	2.10E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	2.06E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	9.16E-13	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.51E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	9.80E-08	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	3.19E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	3.19E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	5.67E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	6.66E-11	mr1846	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	9.03E-14	mr1909	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	2.90E-13	mr1940	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	8.69E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	5.25E-24	mr1024_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	7.30E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	3.58E-40	mr1092_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.40E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	4.35E-15	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	5.49E-41	mr1152_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.26E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.57E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	4.09E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	4.16E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.30E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	1.64E-20	mr1922_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320	NA	2.51E-08	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251