\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219821320:

Variant ID: vg1219821320 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19821320
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.30, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CACGGATCACAAGAGTTTGAAGTATATCTTCACCCAGCCAGATCTGAACATGAGGCAGCAGAGATGGTTGGAACTGATTAAGGATTATGACATGGGAATT[T/C,G]
ATTATCACCCAGGAAAGGCTAATGTTGTAGCAGATGCTCTTAGCAGGAAAGGCTATTGCAATGCTACGGAAGGACGACAGTTGCCGTGGGAATTATGCAA

Reverse complement sequence

TTGCATAATTCCCACGGCAACTGTCGTCCTTCCGTAGCATTGCAATAGCCTTTCCTGCTAAGAGCATCTGCTACAACATTAGCCTTTCCTGGGTGATAAT[A/G,C]
AATTCCCATGTCATAATCCTTAATCAGTTCCAACCATCTCTGCTGCCTCATGTTCAGATCTGGCTGGGTGAAGATATACTTCAAACTCTTGTGATCCGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 7.80% 52.69% 3.66% G: 0.11%
All Indica  2759 8.50% 9.60% 80.54% 1.34% G: 0.07%
All Japonica  1512 86.30% 0.30% 5.22% 8.13% NA
Aus  269 5.60% 32.30% 59.85% 2.23% NA
Indica I  595 7.70% 3.90% 85.21% 3.19% NA
Indica II  465 6.00% 4.30% 88.82% 0.65% G: 0.22%
Indica III  913 8.30% 14.00% 77.33% 0.33% NA
Indica Intermediate  786 10.70% 11.80% 75.83% 1.53% G: 0.13%
Temperate Japonica  767 82.70% 0.10% 4.04% 13.17% NA
Tropical Japonica  504 95.80% 0.40% 3.37% 0.40% NA
Japonica Intermediate  241 78.00% 0.80% 12.86% 8.30% NA
VI/Aromatic  96 85.40% 6.20% 5.21% 3.12% NA
Intermediate  90 61.10% 5.60% 25.56% 4.44% G: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219821320 T -> C LOC_Os12g32800.1 missense_variant ; p.Tyr1167His; MODERATE nonsynonymous_codon ; Y1167H Average:14.622; most accessible tissue: Callus, score: 20.831 possibly damaging -1.781 TOLERATED 1.00
vg1219821320 T -> DEL LOC_Os12g32800.1 N frameshift_variant Average:14.622; most accessible tissue: Callus, score: 20.831 N N N N
vg1219821320 T -> G LOC_Os12g32800.1 missense_variant ; p.Tyr1167Asp; MODERATE nonsynonymous_codon ; Y1167D Average:14.622; most accessible tissue: Callus, score: 20.831 benign -0.015 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219821320 NA 3.18E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.56E-10 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 6.11E-13 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 4.57E-07 1.30E-47 mr1152 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 3.79E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 3.65E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 6.42E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.11E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 4.02E-15 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.11E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 6.58E-12 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.25E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 7.55E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.77E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 4.02E-15 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.82E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 3.03E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 2.10E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 2.06E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 9.16E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.51E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 9.80E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 3.19E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 3.19E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 5.67E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 6.66E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 9.03E-14 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 2.90E-13 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 8.69E-06 mr1992 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 5.25E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 7.30E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 3.58E-40 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.40E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 4.35E-15 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 5.49E-41 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.26E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.57E-06 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 4.09E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 4.16E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.30E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 1.64E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219821320 NA 2.51E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251