\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219816057:

Variant ID: vg1219816057 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19816057
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGGTTCATTGTAGAGCACTAGACTGTGAAGTGGTGGAGATAAGACCACGGGGGTCGCTGGGGAGTCCATGCCTTGTTTATAAGGGGGTGATTATAATC[T/C]
AGGAACGGTGCACTGCTTTGAATTGTATTATGCAGAGGGTACTGTCACAATCTTTATTCGGGTACTTGTTAAGTATCGCGACGCATGGTTGACATGATGT

Reverse complement sequence

ACATCATGTCAACCATGCGTCGCGATACTTAACAAGTACCCGAATAAAGATTGTGACAGTACCCTCTGCATAATACAATTCAAAGCAGTGCACCGTTCCT[A/G]
GATTATAATCACCCCCTTATAAACAAGGCATGGACTCCCCAGCGACCCCCGTGGTCTTATCTCCACCACTTCACAGTCTAGTGCTCTACAATGAACCATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 0.20% 15.26% 42.74% NA
All Indica  2759 13.60% 0.30% 20.62% 65.49% NA
All Japonica  1512 88.40% 0.10% 4.03% 7.47% NA
Aus  269 42.00% 0.00% 29.74% 28.25% NA
Indica I  595 10.60% 0.00% 14.29% 75.13% NA
Indica II  465 8.00% 0.40% 11.61% 80.00% NA
Indica III  913 12.90% 0.10% 32.31% 54.65% NA
Indica Intermediate  786 20.00% 0.60% 17.18% 62.21% NA
Temperate Japonica  767 85.10% 0.10% 4.43% 10.30% NA
Tropical Japonica  504 96.40% 0.00% 0.99% 2.58% NA
Japonica Intermediate  241 82.20% 0.00% 9.13% 8.71% NA
VI/Aromatic  96 91.70% 0.00% 5.21% 3.12% NA
Intermediate  90 67.80% 2.20% 6.67% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219816057 T -> C LOC_Os12g32800.1 intron_variant ; MODIFIER silent_mutation Average:13.339; most accessible tissue: Callus, score: 24.081 N N N N
vg1219816057 T -> DEL N N silent_mutation Average:13.339; most accessible tissue: Callus, score: 24.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219816057 NA 1.53E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 5.46E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 9.25E-07 2.62E-27 mr1024_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 2.20E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 3.66E-10 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 3.90E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.55E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.72E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.18E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 5.61E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.42E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.27E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.80E-09 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 1.39E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 8.89E-07 NA mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 3.49E-23 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 2.05E-06 2.45E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219816057 NA 6.06E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251