\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219796116:

Variant ID: vg1219796116 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19796116
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCAATATTAAAAGGGGTGGCTATCAAGCTAGAAAAGTCGATGGGTTAGGAGGTGGCTGGGTTAGGAGACACAAGGTTTATATAGGTTTAGGCCTTCTC[G/A]
ATGAGAAGTAATACCCTACTCCTGTCTGGGGATTGATCCGCCGAGTGTATTATTGATCGTATGATCAGAAAAGTTATACCCCTAGCAGCACCCAGACCCC

Reverse complement sequence

GGGGTCTGGGTGCTGCTAGGGGTATAACTTTTCTGATCATACGATCAATAATACACTCGGCGGATCAATCCCCAGACAGGAGTAGGGTATTACTTCTCAT[C/T]
GAGAAGGCCTAAACCTATATAAACCTTGTGTCTCCTAACCCAGCCACCTCCTAACCCATCGACTTTTCTAGCTTGATAGCCACCCCTTTTAATATTGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.00% 0.38% 0.19% NA
All Indica  2759 44.30% 54.70% 0.62% 0.33% NA
All Japonica  1512 97.90% 2.10% 0.00% 0.00% NA
Aus  269 50.20% 49.40% 0.37% 0.00% NA
Indica I  595 64.20% 35.30% 0.34% 0.17% NA
Indica II  465 9.70% 89.50% 0.65% 0.22% NA
Indica III  913 52.10% 46.80% 0.55% 0.55% NA
Indica Intermediate  786 40.70% 58.10% 0.89% 0.25% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219796116 G -> DEL N N silent_mutation Average:75.223; most accessible tissue: Minghui63 flag leaf, score: 92.994 N N N N
vg1219796116 G -> A LOC_Os12g32760.1 upstream_gene_variant ; 4633.0bp to feature; MODIFIER silent_mutation Average:75.223; most accessible tissue: Minghui63 flag leaf, score: 92.994 N N N N
vg1219796116 G -> A LOC_Os12g32770.1 downstream_gene_variant ; 2025.0bp to feature; MODIFIER silent_mutation Average:75.223; most accessible tissue: Minghui63 flag leaf, score: 92.994 N N N N
vg1219796116 G -> A LOC_Os12g32770-LOC_Os12g32790 intergenic_region ; MODIFIER silent_mutation Average:75.223; most accessible tissue: Minghui63 flag leaf, score: 92.994 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219796116 G A -0.02 -0.02 -0.01 0.0 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219796116 5.16E-06 NA mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 6.67E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 2.32E-06 NA mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 3.27E-09 mr1141_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 6.36E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 2.99E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 1.96E-06 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 7.72E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 5.93E-06 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 3.59E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 3.84E-10 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 2.15E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 2.55E-07 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219796116 NA 2.61E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251