Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219761908:

Variant ID: vg1219761908 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19761908
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGGCCAATACTATGTATGTTCCCAACCAACAATGGTTGGAGAAATGATGCGACTTTTGGGAAAAAAAAAAGAACTTGTCCTATCACGCTTATATATTC[G/T]
TGGAATCTTAGGCTGAGTTCGAATCTAACCCAACATATGAGCTATGCTAAACGATACATTTATAAAATATTTTTTATATATAAGTTTTTAAGAAATCAAA

Reverse complement sequence

TTTGATTTCTTAAAAACTTATATATAAAAAATATTTTATAAATGTATCGTTTAGCATAGCTCATATGTTGGGTTAGATTCGAACTCAGCCTAAGATTCCA[C/A]
GAATATATAAGCGTGATAGGACAAGTTCTTTTTTTTTTCCCAAAAGTCGCATCATTTCTCCAACCATTGTTGGTTGGGAACATACATAGTATTGGCCCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.50% 0.08% 0.00% NA
All Indica  2759 94.30% 5.50% 0.11% 0.00% NA
All Japonica  1512 16.30% 83.70% 0.00% 0.00% NA
Aus  269 72.10% 27.90% 0.00% 0.00% NA
Indica I  595 94.80% 5.00% 0.17% 0.00% NA
Indica II  465 96.10% 3.90% 0.00% 0.00% NA
Indica III  913 96.20% 3.70% 0.11% 0.00% NA
Indica Intermediate  786 90.80% 9.00% 0.13% 0.00% NA
Temperate Japonica  767 21.10% 78.90% 0.00% 0.00% NA
Tropical Japonica  504 4.80% 95.20% 0.00% 0.00% NA
Japonica Intermediate  241 24.90% 75.10% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 37.80% 61.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219761908 G -> T LOC_Os12g32710.1 upstream_gene_variant ; 3995.0bp to feature; MODIFIER silent_mutation Average:57.276; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg1219761908 G -> T LOC_Os12g32720.1 downstream_gene_variant ; 1984.0bp to feature; MODIFIER silent_mutation Average:57.276; most accessible tissue: Minghui63 flower, score: 75.455 N N N N
vg1219761908 G -> T LOC_Os12g32710-LOC_Os12g32720 intergenic_region ; MODIFIER silent_mutation Average:57.276; most accessible tissue: Minghui63 flower, score: 75.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219761908 4.74E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.11E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 8.49E-06 NA mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.20E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.81E-11 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.78E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.21E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 7.21E-11 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 5.03E-06 mr1209_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 7.95E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 6.32E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.10E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 9.82E-06 mr1266_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 5.50E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.12E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.42E-09 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 5.13E-06 NA mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 3.06E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 5.59E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 3.40E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 7.09E-08 NA mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.01E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.49E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.54E-08 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 4.21E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.43E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 3.55E-08 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.33E-11 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 8.37E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 6.07E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.70E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.14E-13 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.13E-12 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 7.88E-10 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 2.30E-08 7.39E-13 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.14E-14 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.04E-11 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 3.06E-14 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.68E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 9.71E-08 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.09E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.36E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 2.02E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 4.41E-08 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 2.88E-06 NA mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 NA 1.28E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 9.97E-06 1.44E-23 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219761908 1.39E-06 1.64E-12 mr1940_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251