\
| Variant ID: vg1219760769 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19760769 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 88. )
TGAATTTATTACAGCCTTTGTTTCGAGAAATTACAACAAATTGTTACAAAGGCTACGGGCGAATAACCGCGAATTACAAAATATTTCGATTTGAAAAAAA[A/G]
AAATCCCCTCAGTACTCTTTTTTCGCCGGCCGGTAACGGTACGTGCATTGACTATTTTCATTTAGATTTGGAGAAAAAAAAGTTGCAAAGTGGAACAAAC
GTTTGTTCCACTTTGCAACTTTTTTTTCTCCAAATCTAAATGAAAATAGTCAATGCACGTACCGTTACCGGCCGGCGAAAAAAGAGTACTGAGGGGATTT[T/C]
TTTTTTTCAAATCGAAATATTTTGTAATTCGCGGTTATTCGCCCGTAGCCTTTGTAACAATTTGTTGTAATTTCTCGAAACAAAGGCTGTAATAAATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.40% | 34.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 5.60% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 15.90% | 83.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 72.10% | 27.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 8.70% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 20.60% | 79.10% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 24.90% | 75.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 60.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219760769 | A -> G | LOC_Os12g32710.1 | upstream_gene_variant ; 2856.0bp to feature; MODIFIER | silent_mutation | Average:39.276; most accessible tissue: Callus, score: 62.264 | N | N | N | N |
| vg1219760769 | A -> G | LOC_Os12g32720.1 | downstream_gene_variant ; 3123.0bp to feature; MODIFIER | silent_mutation | Average:39.276; most accessible tissue: Callus, score: 62.264 | N | N | N | N |
| vg1219760769 | A -> G | LOC_Os12g32710-LOC_Os12g32720 | intergenic_region ; MODIFIER | silent_mutation | Average:39.276; most accessible tissue: Callus, score: 62.264 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219760769 | 4.05E-06 | NA | mr1142 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 1.05E-06 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 5.41E-06 | 1.74E-26 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 4.27E-11 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.87E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.83E-10 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 6.02E-06 | mr1209_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 6.95E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.48E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 3.12E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 5.82E-07 | mr1272_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.68E-09 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.74E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 3.35E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 6.49E-08 | NA | mr1403_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.82E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.40E-07 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.72E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.43E-08 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 6.54E-12 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 7.47E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.39E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.56E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 3.20E-13 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 6.95E-14 | mr1646_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.75E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 1.06E-08 | 3.85E-13 | mr1681_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 2.54E-06 | 5.29E-12 | mr1751_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.00E-14 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 6.04E-08 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.23E-13 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.16E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.20E-07 | mr1885_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 1.20E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 1.49E-06 | NA | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | NA | 2.36E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 6.28E-06 | 6.13E-24 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219760769 | 2.22E-06 | 2.49E-12 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |