Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219751296:

Variant ID: vg1219751296 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19751296
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCTACCCACAAGGAAAGGCTCAGACGGCAAAAGTCTCACTCCGTGATAGAATCTGACATGCGTAGGTAATGCCGTAACGGAGTCGGACACCAATCGAA[C/T]
ATTGGCGCCGTACTTATAGCAGCGTTCTAAAAACAAAAAGGACTGATTTTAGTCCCTCTCTCCTGTACCCTGCACGTGCATCCCTCTCCACAAGTATACA

Reverse complement sequence

TGTATACTTGTGGAGAGGGATGCACGTGCAGGGTACAGGAGAGAGGGACTAAAATCAGTCCTTTTTGTTTTTAGAACGCTGCTATAAGTACGGCGCCAAT[G/A]
TTCGATTGGTGTCCGACTCCGTTACGGCATTACCTACGCATGTCAGATTCTATCACGGAGTGAGACTTTTGCCGTCTGAGCCTTTCCTTGTGGGTAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.20%	35.90%	11.57%	11.34%	NA
All Indica	2759	56.20%	7.00%	18.74%	18.05%	NA
All Japonica	1512	14.60%	84.50%	0.73%	0.26%	NA
Aus	269	56.50%	30.10%	4.46%	8.92%	NA
Indica I	595	39.70%	6.60%	35.29%	18.49%	NA
Indica II	465	64.50%	3.20%	16.34%	15.91%	NA
Indica III	913	65.30%	5.50%	9.20%	20.04%	NA
Indica Intermediate	786	53.20%	11.50%	18.70%	16.67%	NA
Temperate Japonica	767	19.40%	79.80%	0.65%	0.13%	NA
Tropical Japonica	504	3.20%	95.60%	0.79%	0.40%	NA
Japonica Intermediate	241	22.80%	75.90%	0.83%	0.41%	NA
VI/Aromatic	96	10.40%	88.50%	0.00%	1.04%	NA
Intermediate	90	16.70%	65.60%	7.78%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219751296	C -> DEL	N	N	silent_mutation	Average:21.849; most accessible tissue: Callus, score: 63.127	N	N	N	N
vg1219751296	C -> T	LOC_Os12g32700.1	upstream_gene_variant ; 2020.0bp to feature; MODIFIER	silent_mutation	Average:21.849; most accessible tissue: Callus, score: 63.127	N	N	N	N
vg1219751296	C -> T	LOC_Os12g32710.1	downstream_gene_variant ; 2850.0bp to feature; MODIFIER	silent_mutation	Average:21.849; most accessible tissue: Callus, score: 63.127	N	N	N	N
vg1219751296	C -> T	LOC_Os12g32700-LOC_Os12g32710	intergenic_region ; MODIFIER	silent_mutation	Average:21.849; most accessible tissue: Callus, score: 63.127	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219751296	NA	2.51E-08	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	4.94E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	2.03E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	6.70E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	1.38E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	7.86E-06	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	1.03E-07	NA	mr1403_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	9.01E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	1.15E-09	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	4.32E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	5.75E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	2.63E-10	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	1.66E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	4.29E-06	mr1781_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296	NA	4.52E-09	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251