\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219751296:

Variant ID: vg1219751296 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19751296
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCTACCCACAAGGAAAGGCTCAGACGGCAAAAGTCTCACTCCGTGATAGAATCTGACATGCGTAGGTAATGCCGTAACGGAGTCGGACACCAATCGAA[C/T]
ATTGGCGCCGTACTTATAGCAGCGTTCTAAAAACAAAAAGGACTGATTTTAGTCCCTCTCTCCTGTACCCTGCACGTGCATCCCTCTCCACAAGTATACA

Reverse complement sequence

TGTATACTTGTGGAGAGGGATGCACGTGCAGGGTACAGGAGAGAGGGACTAAAATCAGTCCTTTTTGTTTTTAGAACGCTGCTATAAGTACGGCGCCAAT[G/A]
TTCGATTGGTGTCCGACTCCGTTACGGCATTACCTACGCATGTCAGATTCTATCACGGAGTGAGACTTTTGCCGTCTGAGCCTTTCCTTGTGGGTAGAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.20% 35.90% 11.57% 11.34% NA
All Indica  2759 56.20% 7.00% 18.74% 18.05% NA
All Japonica  1512 14.60% 84.50% 0.73% 0.26% NA
Aus  269 56.50% 30.10% 4.46% 8.92% NA
Indica I  595 39.70% 6.60% 35.29% 18.49% NA
Indica II  465 64.50% 3.20% 16.34% 15.91% NA
Indica III  913 65.30% 5.50% 9.20% 20.04% NA
Indica Intermediate  786 53.20% 11.50% 18.70% 16.67% NA
Temperate Japonica  767 19.40% 79.80% 0.65% 0.13% NA
Tropical Japonica  504 3.20% 95.60% 0.79% 0.40% NA
Japonica Intermediate  241 22.80% 75.90% 0.83% 0.41% NA
VI/Aromatic  96 10.40% 88.50% 0.00% 1.04% NA
Intermediate  90 16.70% 65.60% 7.78% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219751296 C -> DEL N N silent_mutation Average:21.849; most accessible tissue: Callus, score: 63.127 N N N N
vg1219751296 C -> T LOC_Os12g32700.1 upstream_gene_variant ; 2020.0bp to feature; MODIFIER silent_mutation Average:21.849; most accessible tissue: Callus, score: 63.127 N N N N
vg1219751296 C -> T LOC_Os12g32710.1 downstream_gene_variant ; 2850.0bp to feature; MODIFIER silent_mutation Average:21.849; most accessible tissue: Callus, score: 63.127 N N N N
vg1219751296 C -> T LOC_Os12g32700-LOC_Os12g32710 intergenic_region ; MODIFIER silent_mutation Average:21.849; most accessible tissue: Callus, score: 63.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219751296 NA 2.51E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 4.94E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 2.03E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 6.70E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 1.38E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 7.86E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 1.03E-07 NA mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 9.01E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 1.15E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 4.32E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 5.75E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 2.63E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 1.66E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 4.29E-06 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219751296 NA 4.52E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251