\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219661684:

Variant ID: vg1219661684 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19661684
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATCACAATCTTCCTCTAATTATTTTTACCTATTTTTTAATATATGTGTCTATCTCAAAAGGTGCTAATATTTATGGGATTCCCTCGTTCTAACATATAAA[G/A]
GATTTTAGATAGATGAGTACTCCCTTTATCCAAAAAAAAACTCAACCTAGTACTTGAATAGGACATAATCTAATATAATGAATATGGACAAAGGTGGAGT

Reverse complement sequence

ACTCCACCTTTGTCCATATTCATTATATTAGATTATGTCCTATTCAAGTACTAGGTTGAGTTTTTTTTTGGATAAAGGGAGTACTCATCTATCTAAAATC[C/T]
TTTATATGTTAGAACGAGGGAATCCCATAAATATTAGCACCTTTTGAGATAGACACATATATTAAAAAATAGGTAAAAATAATTAGAGGAAGATTGTGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.10% 0.25% 0.23% NA
All Indica  2759 91.50% 8.20% 0.29% 0.00% NA
All Japonica  1512 2.30% 97.60% 0.07% 0.00% NA
Aus  269 58.00% 36.80% 1.12% 4.09% NA
Indica I  595 96.80% 3.00% 0.17% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 90.70% 9.10% 0.22% 0.00% NA
Indica Intermediate  786 85.50% 13.90% 0.64% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 30.00% 70.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219661684 G -> DEL N N silent_mutation Average:60.33; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg1219661684 G -> A LOC_Os12g32580.1 upstream_gene_variant ; 1162.0bp to feature; MODIFIER silent_mutation Average:60.33; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg1219661684 G -> A LOC_Os12g32590.1 upstream_gene_variant ; 1423.0bp to feature; MODIFIER silent_mutation Average:60.33; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg1219661684 G -> A LOC_Os12g32580-LOC_Os12g32590 intergenic_region ; MODIFIER silent_mutation Average:60.33; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219661684 NA 7.08E-12 mr1940 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.56E-27 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.61E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.78E-39 mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.43E-11 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.94E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 4.16E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.20E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 3.95E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 5.70E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 9.08E-35 mr1223_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.31E-06 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 8.81E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 3.29E-22 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.95E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.13E-07 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.74E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.39E-07 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.18E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 8.95E-12 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.63E-15 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 8.54E-08 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 8.66E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 7.02E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 3.25E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.33E-21 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.33E-08 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.11E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 6.57E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 2.03E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 4.13E-06 NA mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 4.28E-06 3.79E-26 mr1922_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 8.71E-24 mr1924_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 3.64E-06 4.26E-12 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 1.23E-24 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219661684 NA 5.59E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251