\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219656292:

Variant ID: vg1219656292 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19656292
Reference Allele: AAlternative Allele: C,G
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, A: 0.12, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAGGCGGAGCTAGGACCTCACCAGGGGGACGGCGACGTTTAGGATCAGTGCCGTTGTCTGGGATATATAGGGCTCCTGAGGGCGCAGGGCCGTGGATA[A/C,G]
GCAGAGTGGAGGAACGTTGCCAAGGGCACCAGCCAATGCCACCACTAATGTTGCCAATGTCAGAGGATAATGAGGAAAAGAGAAGAGGGATGGAGGGGGG

Reverse complement sequence

CCCCCCTCCATCCCTCTTCTCTTTTCCTCATTATCCTCTGACATTGGCAACATTAGTGGTGGCATTGGCTGGTGCCCTTGGCAACGTTCCTCCACTCTGC[T/G,C]
TATCCACGGCCCTGCGCCCTCAGGAGCCCTATATATCCCAGACAACGGCACTGATCCTAAACGTCGCCGTCCCCCTGGTGAGGTCCTAGCTCCGCCTTGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 32.40% 0.21% 2.88% G: 4.51%
All Indica  2759 87.60% 3.00% 0.25% 4.82% G: 4.31%
All Japonica  1512 13.00% 86.80% 0.07% 0.07% G: 0.07%
Aus  269 68.00% 1.10% 0.37% 0.00% G: 30.48%
Indica I  595 96.10% 2.20% 0.34% 1.34% NA
Indica II  465 80.20% 2.40% 0.00% 16.99% G: 0.43%
Indica III  913 89.00% 1.40% 0.11% 1.97% G: 7.45%
Indica Intermediate  786 83.70% 6.00% 0.51% 3.56% G: 6.23%
Temperate Japonica  767 17.50% 82.40% 0.00% 0.00% G: 0.13%
Tropical Japonica  504 3.80% 96.20% 0.00% 0.00% NA
Japonica Intermediate  241 18.30% 80.90% 0.41% 0.41% NA
VI/Aromatic  96 16.70% 79.20% 0.00% 0.00% G: 4.17%
Intermediate  90 27.80% 61.10% 1.11% 2.22% G: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219656292 A -> C LOC_Os12g32560.1 downstream_gene_variant ; 2569.0bp to feature; MODIFIER silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N
vg1219656292 A -> C LOC_Os12g32580.1 downstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N
vg1219656292 A -> C LOC_Os12g32560-LOC_Os12g32580 intergenic_region ; MODIFIER silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N
vg1219656292 A -> DEL N N silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N
vg1219656292 A -> G LOC_Os12g32560.1 downstream_gene_variant ; 2569.0bp to feature; MODIFIER silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N
vg1219656292 A -> G LOC_Os12g32580.1 downstream_gene_variant ; 610.0bp to feature; MODIFIER silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N
vg1219656292 A -> G LOC_Os12g32560-LOC_Os12g32580 intergenic_region ; MODIFIER silent_mutation Average:91.019; most accessible tissue: Zhenshan97 flag leaf, score: 96.018 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219656292 A C -0.01 -0.01 0.0 -0.01 -0.01 -0.01
vg1219656292 A G -0.01 -0.01 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219656292 NA 1.24E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 3.69E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 3.09E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 7.95E-10 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 7.05E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 1.00E-08 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 4.14E-09 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 7.29E-07 mr1227_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 6.29E-08 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 4.98E-09 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 1.98E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 1.39E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 8.76E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 5.51E-10 mr1668_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 4.03E-10 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 4.13E-10 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 4.96E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 7.88E-06 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 5.71E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 1.09E-06 NA mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 7.11E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 4.30E-20 mr1922_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219656292 NA 2.73E-11 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251