Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219593314:

Variant ID: vg1219593314 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19593314
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGGAATTTAGATGAGCTGCTGGGGATGCTCTAAGGTCGACGAAGGAAGAAAGCCGTTAGGGCCGCTAGGGAACAGTGGTGTACACCGCAACCACCCAA[A/G]
GAGGAAGCCCACCGTTGATCAAGTTCCTGGCAATTTCGTCGACGTCAACGAGAAGGGGACCAACCAATTCTATTGCCCTCGCATGAAGCCTCCCACTGCT

Reverse complement sequence

AGCAGTGGGAGGCTTCATGCGAGGGCAATAGAATTGGTTGGTCCCCTTCTCGTTGACGTCGACGAAATTGCCAGGAACTTGATCAACGGTGGGCTTCCTC[T/C]
TTGGGTGGTTGCGGTGTACACCACTGTTCCCTAGCGGCCCTAACGGCTTTCTTCCTTCGTCGACCTTAGAGCATCCCCAGCAGCTCATCTAAATTCCATC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.30%	9.10%	0.42%	54.15%	NA
All Indica	2759	4.20%	5.00%	0.65%	90.11%	NA
All Japonica	1512	96.60%	1.00%	0.00%	2.38%	NA
Aus	269	1.50%	94.40%	0.37%	3.72%	NA
Indica I	595	3.40%	0.50%	0.34%	95.80%	NA
Indica II	465	3.20%	2.40%	0.22%	94.19%	NA
Indica III	913	2.80%	7.80%	0.44%	88.94%	NA
Indica Intermediate	786	7.00%	6.90%	1.40%	84.73%	NA
Temperate Japonica	767	97.90%	0.50%	0.00%	1.56%	NA
Tropical Japonica	504	96.40%	0.40%	0.00%	3.17%	NA
Japonica Intermediate	241	92.90%	3.70%	0.00%	3.32%	NA
VI/Aromatic	96	82.30%	14.60%	0.00%	3.12%	NA
Intermediate	90	63.30%	8.90%	1.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219593314	A -> DEL	N	N	silent_mutation	Average:12.108; most accessible tissue: Callus, score: 58.135	N	N	N	N
vg1219593314	A -> G	LOC_Os12g32470.1	upstream_gene_variant ; 3681.0bp to feature; MODIFIER	silent_mutation	Average:12.108; most accessible tissue: Callus, score: 58.135	N	N	N	N
vg1219593314	A -> G	LOC_Os12g32450-LOC_Os12g32470	intergenic_region ; MODIFIER	silent_mutation	Average:12.108; most accessible tissue: Callus, score: 58.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219593314	NA	3.59E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	NA	6.28E-09	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	4.65E-06	2.04E-06	mr1206_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	3.27E-06	3.27E-06	mr1357_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	9.63E-06	4.73E-06	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	NA	3.52E-15	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	NA	6.05E-06	mr1901_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	NA	9.38E-06	mr1906_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	5.25E-06	5.25E-06	mr1941_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	8.21E-06	1.81E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	NA	7.58E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	2.67E-06	2.67E-06	mr1953_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314	NA	4.36E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251