\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219593314:

Variant ID: vg1219593314 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19593314
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGAATTTAGATGAGCTGCTGGGGATGCTCTAAGGTCGACGAAGGAAGAAAGCCGTTAGGGCCGCTAGGGAACAGTGGTGTACACCGCAACCACCCAA[A/G]
GAGGAAGCCCACCGTTGATCAAGTTCCTGGCAATTTCGTCGACGTCAACGAGAAGGGGACCAACCAATTCTATTGCCCTCGCATGAAGCCTCCCACTGCT

Reverse complement sequence

AGCAGTGGGAGGCTTCATGCGAGGGCAATAGAATTGGTTGGTCCCCTTCTCGTTGACGTCGACGAAATTGCCAGGAACTTGATCAACGGTGGGCTTCCTC[T/C]
TTGGGTGGTTGCGGTGTACACCACTGTTCCCTAGCGGCCCTAACGGCTTTCTTCCTTCGTCGACCTTAGAGCATCCCCAGCAGCTCATCTAAATTCCATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.30% 9.10% 0.42% 54.15% NA
All Indica  2759 4.20% 5.00% 0.65% 90.11% NA
All Japonica  1512 96.60% 1.00% 0.00% 2.38% NA
Aus  269 1.50% 94.40% 0.37% 3.72% NA
Indica I  595 3.40% 0.50% 0.34% 95.80% NA
Indica II  465 3.20% 2.40% 0.22% 94.19% NA
Indica III  913 2.80% 7.80% 0.44% 88.94% NA
Indica Intermediate  786 7.00% 6.90% 1.40% 84.73% NA
Temperate Japonica  767 97.90% 0.50% 0.00% 1.56% NA
Tropical Japonica  504 96.40% 0.40% 0.00% 3.17% NA
Japonica Intermediate  241 92.90% 3.70% 0.00% 3.32% NA
VI/Aromatic  96 82.30% 14.60% 0.00% 3.12% NA
Intermediate  90 63.30% 8.90% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219593314 A -> DEL N N silent_mutation Average:12.108; most accessible tissue: Callus, score: 58.135 N N N N
vg1219593314 A -> G LOC_Os12g32470.1 upstream_gene_variant ; 3681.0bp to feature; MODIFIER silent_mutation Average:12.108; most accessible tissue: Callus, score: 58.135 N N N N
vg1219593314 A -> G LOC_Os12g32450-LOC_Os12g32470 intergenic_region ; MODIFIER silent_mutation Average:12.108; most accessible tissue: Callus, score: 58.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219593314 NA 3.59E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 NA 6.28E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 4.65E-06 2.04E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 3.27E-06 3.27E-06 mr1357_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 9.63E-06 4.73E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 NA 3.52E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 NA 6.05E-06 mr1901_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 NA 9.38E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 5.25E-06 5.25E-06 mr1941_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 8.21E-06 1.81E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 NA 7.58E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 2.67E-06 2.67E-06 mr1953_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593314 NA 4.36E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251