Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219593045:

Variant ID: vg1219593045 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19593045
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACCCCTCCGCCTGGCGACTCCTCTGCCCAAGCCGCCCCGCCGGTTGGCTCTTGTCCTCCTCGCCCTCTCGATGGTAGAAAAGAGAGAAGTGTGTGGAAG[T/A]
GTTTTTTTTAGAGCGGTGAAAGCTGAGTATAAATATGTGGTAGTTGTAAAATATTAGTAAAATATAGGATGTTGGTATATAGATGATGTAATATGGATGA

Reverse complement sequence

TCATCCATATTACATCATCTATATACCAACATCCTATATTTTACTAATATTTTACAACTACCACATATTTATACTCAGCTTTCACCGCTCTAAAAAAAAC[A/T]
CTTCCACACACTTCTCTCTTTTCTACCATCGAGAGGGCGAGGAGGACAAGAGCCAACCGGCGGGGCGGCTTGGGCAGAGGAGTCGCCAGGCGGAGGGGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	9.00%	1.38%	52.18%	NA
All Indica	2759	6.00%	4.90%	2.28%	86.81%	NA
All Japonica	1512	96.80%	0.90%	0.07%	2.25%	NA
Aus	269	1.90%	94.10%	0.37%	3.72%	NA
Indica I	595	3.70%	0.30%	3.87%	92.10%	NA
Indica II	465	4.10%	2.20%	0.86%	92.90%	NA
Indica III	913	6.80%	7.60%	2.30%	83.35%	NA
Indica Intermediate	786	8.00%	6.90%	1.91%	83.21%	NA
Temperate Japonica	767	98.20%	0.40%	0.00%	1.43%	NA
Tropical Japonica	504	96.40%	0.40%	0.20%	2.98%	NA
Japonica Intermediate	241	92.90%	3.70%	0.00%	3.32%	NA
VI/Aromatic	96	82.30%	14.60%	0.00%	3.12%	NA
Intermediate	90	63.30%	10.00%	0.00%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219593045	T -> DEL	N	N	silent_mutation	Average:13.048; most accessible tissue: Callus, score: 59.477	N	N	N	N
vg1219593045	T -> A	LOC_Os12g32470.1	upstream_gene_variant ; 3950.0bp to feature; MODIFIER	silent_mutation	Average:13.048; most accessible tissue: Callus, score: 59.477	N	N	N	N
vg1219593045	T -> A	LOC_Os12g32450-LOC_Os12g32470	intergenic_region ; MODIFIER	silent_mutation	Average:13.048; most accessible tissue: Callus, score: 59.477	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219593045	NA	2.73E-06	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	5.00E-07	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	5.13E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	6.17E-10	mr1166_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	3.40E-06	1.63E-06	mr1206_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	4.70E-06	4.70E-06	mr1357_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	5.09E-06	2.82E-06	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	9.37E-06	mr1432_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	4.17E-06	NA	mr1730_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	1.20E-16	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	6.80E-06	6.52E-06	mr1862_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	7.62E-06	mr1901_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	6.84E-06	mr1906_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	1.49E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	9.70E-06	mr1909_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	NA	8.58E-06	mr1938_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	2.67E-06	2.67E-06	mr1941_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	8.36E-06	2.54E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	3.71E-06	3.71E-06	mr1953_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045	7.67E-06	3.73E-06	mr1980_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251