\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219593045:

Variant ID: vg1219593045 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19593045
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCCCTCCGCCTGGCGACTCCTCTGCCCAAGCCGCCCCGCCGGTTGGCTCTTGTCCTCCTCGCCCTCTCGATGGTAGAAAAGAGAGAAGTGTGTGGAAG[T/A]
GTTTTTTTTAGAGCGGTGAAAGCTGAGTATAAATATGTGGTAGTTGTAAAATATTAGTAAAATATAGGATGTTGGTATATAGATGATGTAATATGGATGA

Reverse complement sequence

TCATCCATATTACATCATCTATATACCAACATCCTATATTTTACTAATATTTTACAACTACCACATATTTATACTCAGCTTTCACCGCTCTAAAAAAAAC[A/T]
CTTCCACACACTTCTCTCTTTTCTACCATCGAGAGGGCGAGGAGGACAAGAGCCAACCGGCGGGGCGGCTTGGGCAGAGGAGTCGCCAGGCGGAGGGGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 9.00% 1.38% 52.18% NA
All Indica  2759 6.00% 4.90% 2.28% 86.81% NA
All Japonica  1512 96.80% 0.90% 0.07% 2.25% NA
Aus  269 1.90% 94.10% 0.37% 3.72% NA
Indica I  595 3.70% 0.30% 3.87% 92.10% NA
Indica II  465 4.10% 2.20% 0.86% 92.90% NA
Indica III  913 6.80% 7.60% 2.30% 83.35% NA
Indica Intermediate  786 8.00% 6.90% 1.91% 83.21% NA
Temperate Japonica  767 98.20% 0.40% 0.00% 1.43% NA
Tropical Japonica  504 96.40% 0.40% 0.20% 2.98% NA
Japonica Intermediate  241 92.90% 3.70% 0.00% 3.32% NA
VI/Aromatic  96 82.30% 14.60% 0.00% 3.12% NA
Intermediate  90 63.30% 10.00% 0.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219593045 T -> DEL N N silent_mutation Average:13.048; most accessible tissue: Callus, score: 59.477 N N N N
vg1219593045 T -> A LOC_Os12g32470.1 upstream_gene_variant ; 3950.0bp to feature; MODIFIER silent_mutation Average:13.048; most accessible tissue: Callus, score: 59.477 N N N N
vg1219593045 T -> A LOC_Os12g32450-LOC_Os12g32470 intergenic_region ; MODIFIER silent_mutation Average:13.048; most accessible tissue: Callus, score: 59.477 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219593045 NA 2.73E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 5.00E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 5.13E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 6.17E-10 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 3.40E-06 1.63E-06 mr1206_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 4.70E-06 4.70E-06 mr1357_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 5.09E-06 2.82E-06 mr1381_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 9.37E-06 mr1432_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 4.17E-06 NA mr1730_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 1.20E-16 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 6.80E-06 6.52E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 7.62E-06 mr1901_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 6.84E-06 mr1906_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 1.49E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 9.70E-06 mr1909_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 NA 8.58E-06 mr1938_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 2.67E-06 2.67E-06 mr1941_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 8.36E-06 2.54E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 3.71E-06 3.71E-06 mr1953_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219593045 7.67E-06 3.73E-06 mr1980_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251