\
| Variant ID: vg1219591736 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19591736 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACAGATCAATACCTATAAATTTAATTTATTTTATTGATATATCAATTGTAATGATTACTTAGGACAACATTTTTTTAATAAAAAAACAAAAGTAACAAAT[G/C]
GAGCAGCGAAGGACATAGCTGCAATATATTTTCTTGTTAGTGGAGCTGCAGCTATGTTGTAGTTCGGGCATGTTAGTGGAGCTGCAGCTATGTTGTAGTT
AACTACAACATAGCTGCAGCTCCACTAACATGCCCGAACTACAACATAGCTGCAGCTCCACTAACAAGAAAATATATTGCAGCTATGTCCTTCGCTGCTC[C/G]
ATTTGTTACTTTTGTTTTTTTATTAAAAAAATGTTGTCCTAAGTAATCATTACAATTGATATATCAATAAAATAAATTAAATTTATAGGTATTGATCTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 7.40% | 2.01% | 54.21% | NA |
| All Indica | 2759 | 4.20% | 4.50% | 1.01% | 90.25% | NA |
| All Japonica | 1512 | 96.60% | 0.90% | 0.13% | 2.31% | NA |
| Aus | 269 | 1.90% | 71.00% | 23.42% | 3.72% | NA |
| Indica I | 595 | 3.70% | 0.30% | 0.17% | 95.80% | NA |
| Indica II | 465 | 3.40% | 2.20% | 1.94% | 92.47% | NA |
| Indica III | 913 | 2.40% | 7.60% | 0.44% | 89.59% | NA |
| Indica Intermediate | 786 | 7.10% | 5.60% | 1.78% | 85.50% | NA |
| Temperate Japonica | 767 | 98.00% | 0.40% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 96.20% | 0.40% | 0.20% | 3.17% | NA |
| Japonica Intermediate | 241 | 92.90% | 3.70% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 82.30% | 14.60% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 63.30% | 7.80% | 2.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219591736 | G -> C | LOC_Os12g32450-LOC_Os12g32470 | intergenic_region ; MODIFIER | silent_mutation | Average:11.26; most accessible tissue: Callus, score: 48.032 | N | N | N | N |
| vg1219591736 | G -> DEL | N | N | silent_mutation | Average:11.26; most accessible tissue: Callus, score: 48.032 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219591736 | NA | 8.44E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 2.25E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 8.07E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 2.86E-10 | mr1166_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 3.71E-06 | 1.98E-06 | mr1206_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 3.33E-06 | 3.33E-06 | mr1357_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 3.20E-06 | 2.19E-06 | mr1381_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 6.85E-06 | mr1432_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 7.89E-06 | NA | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 1.66E-16 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 7.61E-06 | mr1901_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 5.11E-06 | mr1906_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 1.13E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 5.54E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 1.32E-06 | 1.32E-06 | mr1941_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | NA | 4.96E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 3.76E-06 | 3.76E-06 | mr1953_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219591736 | 2.48E-06 | 1.65E-06 | mr1980_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |