\
| Variant ID: vg1219590404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19590404 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TAAAATGAGGTCCTTCACTGTAGTAGAACTGTCAGGCTATAAAAGTTACCACTAGCAAAACTTTATGGTTGCCTGCAGGCTGGCTGGCCAAGGCAGAGCT[A/G]
CATAGCGCAGAACTGCAAGGAGTAGCTAGCTAGTAGGTACGTGTCGACATGCCACAGGGCAGAGGCGCACAGCACAATAATCGATCGGCGAAAGAGCTCC
GGAGCTCTTTCGCCGATCGATTATTGTGCTGTGCGCCTCTGCCCTGTGGCATGTCGACACGTACCTACTAGCTAGCTACTCCTTGCAGTTCTGCGCTATG[T/C]
AGCTCTGCCTTGGCCAGCCAGCCTGCAGGCAACCATAAAGTTTTGCTAGTGGTAACTTTTATAGCCTGACAGTTCTACTACAGTGAAGGACCTCATTTTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.20% | 7.40% | 0.68% | 53.70% | NA |
| All Indica | 2759 | 4.80% | 4.70% | 1.09% | 89.42% | NA |
| All Japonica | 1512 | 96.80% | 0.90% | 0.00% | 2.31% | NA |
| Aus | 269 | 27.10% | 68.80% | 0.37% | 3.72% | NA |
| Indica I | 595 | 4.20% | 0.30% | 0.50% | 94.96% | NA |
| Indica II | 465 | 3.40% | 2.40% | 1.94% | 92.26% | NA |
| Indica III | 913 | 3.40% | 7.70% | 0.88% | 88.06% | NA |
| Indica Intermediate | 786 | 7.80% | 5.90% | 1.27% | 85.11% | NA |
| Temperate Japonica | 767 | 98.20% | 0.40% | 0.00% | 1.43% | NA |
| Tropical Japonica | 504 | 96.40% | 0.40% | 0.00% | 3.17% | NA |
| Japonica Intermediate | 241 | 92.90% | 3.70% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 82.30% | 14.60% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 63.30% | 10.00% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219590404 | A -> DEL | N | N | silent_mutation | Average:15.387; most accessible tissue: Callus, score: 95.855 | N | N | N | N |
| vg1219590404 | A -> G | LOC_Os12g32450-LOC_Os12g32470 | intergenic_region ; MODIFIER | silent_mutation | Average:15.387; most accessible tissue: Callus, score: 95.855 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219590404 | NA | 4.38E-06 | mr1545 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 2.89E-06 | mr1808 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 9.13E-07 | NA | mr1045_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 9.06E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 3.59E-07 | 7.13E-06 | mr1206_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 2.63E-06 | 1.41E-06 | mr1206_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 8.50E-06 | NA | mr1308_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 2.81E-06 | NA | mr1381_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 3.45E-06 | 2.18E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 7.87E-06 | NA | mr1578_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 6.66E-07 | NA | mr1581_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 2.64E-06 | NA | mr1730_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 5.88E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 1.10E-15 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 9.75E-06 | mr1862_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 5.26E-06 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 6.06E-07 | NA | mr1901_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 9.13E-06 | 9.12E-06 | mr1906_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 3.21E-07 | 6.88E-10 | mr1909_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 3.76E-06 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 1.36E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 1.19E-06 | NA | mr1938_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 5.38E-06 | 5.38E-06 | mr1941_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 7.46E-06 | mr1943_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | NA | 4.10E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219590404 | 8.35E-06 | 8.35E-06 | mr1953_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |