Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1219585537:

Variant ID: vg1219585537 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19585537
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTACCACAGTAGGACTTCAGCTGGTTTCTGGGGACAGCAATACTTTAATGCTACTGCTGCATGTTGCAGTAATAAATATTACTCCGTACTAAAATAAGTG[C/T]
AGTTTTACACTATTCATCTCCAACGTTTGACCGTTCATATTATTTGAAATTTTTTTATGATTACTATTTTTATTATTATTAGATAATAAAGCATGAATAG

Reverse complement sequence

CTATTCATGCTTTATTATCTAATAATAATAAAAATAGTAATCATAAAAAAATTTCAAATAATATGAACGGTCAAACGTTGGAGATGAATAGTGTAAAACT[G/A]
CACTTATTTTAGTACGGAGTAATATTTATTACTGCAACATGCAGCAGTAGCATTAAAGTATTGCTGTCCCCAGAAACCAGCTGAAGTCCTACTGTGGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 2.50% 0.80% 4.68% NA
All Indica  2759 86.70% 4.10% 1.30% 7.83% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 88.10% 8.20% 2.86% 0.84% NA
Indica II  465 79.40% 3.20% 1.51% 15.91% NA
Indica III  913 91.30% 0.10% 0.55% 8.00% NA
Indica Intermediate  786 84.70% 6.20% 0.89% 8.14% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 1.10% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219585537 C -> DEL N N silent_mutation Average:70.128; most accessible tissue: Callus, score: 97.756 N N N N
vg1219585537 C -> T LOC_Os12g32450.1 upstream_gene_variant ; 372.0bp to feature; MODIFIER silent_mutation Average:70.128; most accessible tissue: Callus, score: 97.756 N N N N
vg1219585537 C -> T LOC_Os12g32450-LOC_Os12g32470 intergenic_region ; MODIFIER silent_mutation Average:70.128; most accessible tissue: Callus, score: 97.756 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219585537 C T 0.02 0.02 -0.01 -0.03 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219585537 4.11E-11 2.31E-21 mr1038 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219585537 3.17E-10 1.73E-11 mr1141 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219585537 1.09E-12 4.95E-25 mr1389 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219585537 1.17E-15 1.91E-27 mr1038_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219585537 1.23E-10 2.98E-11 mr1141_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219585537 6.13E-17 2.30E-29 mr1389_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251