\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219556752:

Variant ID: vg1219556752 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19556752
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


GCCGTGCGTATTAACCAAGCCGTGTAATCGGAAATAAACTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGT[T/C]
CAAGAGCCTTATCTTCCGAGAAGAATTCTCCGATGACAAGGCTGGGGGCTAGGGAGAGTGTATAACTCAAACGACTGATTGAAGTCGCGAAATGAGAAGA

Reverse complement sequence

TCTTCTCATTTCGCGACTTCAATCAGTCGTTTGAGTTATACACTCTCCCTAGCCCCCAGCCTTGTCATCGGAGAATTCTTCTCGGAAGATAAGGCTCTTG[A/G]
ACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTTTATTTCCGATTACACGGCTTGGTTAATACGCACGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 32.10% 1.06% 1.33% NA
All Indica  2759 92.30% 3.70% 1.81% 2.25% NA
All Japonica  1512 15.30% 84.70% 0.00% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.30% 2.70% 0.67% 0.34% NA
Indica II  465 81.30% 3.90% 6.45% 8.39% NA
Indica III  913 96.90% 1.60% 0.44% 0.99% NA
Indica Intermediate  786 90.30% 6.60% 1.53% 1.53% NA
Temperate Japonica  767 20.60% 79.40% 0.00% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 22.00% 77.60% 0.00% 0.41% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219556752 T -> C LOC_Os12g32410.1 downstream_gene_variant ; 4521.0bp to feature; MODIFIER silent_mutation Average:32.0; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1219556752 T -> C LOC_Os12g32420.1 downstream_gene_variant ; 661.0bp to feature; MODIFIER silent_mutation Average:32.0; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1219556752 T -> C LOC_Os12g32430.1 downstream_gene_variant ; 870.0bp to feature; MODIFIER silent_mutation Average:32.0; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1219556752 T -> C LOC_Os12g32420-LOC_Os12g32430 intergenic_region ; MODIFIER silent_mutation Average:32.0; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N
vg1219556752 T -> DEL N N silent_mutation Average:32.0; most accessible tissue: Zhenshan97 flag leaf, score: 55.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219556752 NA 3.17E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 1.17E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 4.91E-06 4.91E-06 mr1360 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 2.60E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 1.39E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 2.38E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 1.40E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 6.91E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 6.41E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 6.73E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 1.79E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 1.73E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 7.37E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 6.24E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 3.89E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556752 NA 1.25E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251