Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219556254:

Variant ID: vg1219556254 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19556254
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCGTTACCACGAGAAGCGCATCCGAGCACGCACTCTTTCGATCGGCGACTACGTCCTCTGACGGGTTCAAAGCCAAGCAGGGCGAAACAAACTCTCAC[C/T]
CAAATGGGAAGGACCGTACACAATCACACAAGTTCTGCGGCCAGGCGCATTCAAAATTGCAGACGGCGATGGTCGCGAGTTGGCAAATTCCTGGAACATT

Reverse complement sequence

AATGTTCCAGGAATTTGCCAACTCGCGACCATCGCCGTCTGCAATTTTGAATGCGCCTGGCCGCAGAACTTGTGTGATTGTGTACGGTCCTTCCCATTTG[G/A]
GTGAGAGTTTGTTTCGCCCTGCTTGGCTTTGAACCCGTCAGAGGACGTAGTCGCCGATCGAAAGAGTGCGTGCTCGGATGCGCTTCTCGTGGTAACGACG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	11.60%	0.08%	0.93%	NA
All Indica	2759	78.90%	19.40%	0.14%	1.56%	NA
All Japonica	1512	99.50%	0.40%	0.00%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.30%	0.00%	0.34%	NA
Indica II	465	42.20%	51.20%	0.65%	6.02%	NA
Indica III	913	84.60%	15.00%	0.11%	0.33%	NA
Indica Intermediate	786	78.50%	20.20%	0.00%	1.27%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219556254	C -> DEL	N	N	silent_mutation	Average:34.681; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1219556254	C -> T	LOC_Os12g32410.1	downstream_gene_variant ; 4023.0bp to feature; MODIFIER	silent_mutation	Average:34.681; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1219556254	C -> T	LOC_Os12g32420.1	downstream_gene_variant ; 163.0bp to feature; MODIFIER	silent_mutation	Average:34.681; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1219556254	C -> T	LOC_Os12g32430.1	downstream_gene_variant ; 1368.0bp to feature; MODIFIER	silent_mutation	Average:34.681; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N
vg1219556254	C -> T	LOC_Os12g32420-LOC_Os12g32430	intergenic_region ; MODIFIER	silent_mutation	Average:34.681; most accessible tissue: Zhenshan97 flag leaf, score: 58.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219556254	NA	6.94E-11	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.81E-08	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.81E-08	mr1024_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.80E-06	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	9.17E-06	mr1045_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.96E-06	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.96E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	6.08E-10	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	4.31E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.07E-11	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	7.93E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	7.15E-06	mr1230_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.27E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.81E-07	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.62E-06	mr1295_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.47E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.59E-06	mr1388_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.19E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.23E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.26E-06	mr1421_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	9.57E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	5.65E-06	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	8.00E-06	mr1492_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.60E-07	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	2.06E-06	2.07E-06	mr1500_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.95E-06	mr1500_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.03E-06	mr1554_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.61E-08	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.69E-06	mr1562_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.16E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	5.79E-07	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.79E-07	mr1790_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.12E-07	mr1805_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	9.15E-10	mr1829_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	4.46E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.43E-08	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	4.95E-07	mr1842_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	4.28E-08	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.44E-07	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.23E-08	mr1885_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	3.84E-07	mr1915_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	5.76E-06	mr1930_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	1.16E-06	mr1930_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	5.79E-07	5.81E-07	mr1956_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219556254	NA	2.01E-06	mr1956_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251