Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219503084:

Variant ID: vg1219503084 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19503084
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TAACCAACCGCTGCAATTTCCTATCTACCCTAAACAACTCACGGAATTTGGTGAGTTGTCAGCATATTACAATAAGATGTTTGTGGGTAAGTTTTAAAAA[T/A]
TTTCATCTTTATATTATGGGAAAAAAATGACAAATTGTGTTATTAGCAATATGTTGGCTGACACCTTTTTTTTTAGACATTGCTGGTGTTATTGTGTATC

Reverse complement sequence

GATACACAATAACACCAGCAATGTCTAAAAAAAAAGGTGTCAGCCAACATATTGCTAATAACACAATTTGTCATTTTTTTCCCATAATATAAAGATGAAA[A/T]
TTTTTAAAACTTACCCACAAACATCTTATTGTAATATGCTGACAACTCACCAAATTCCGTGAGTTGTTTAGGGTAGATAGGAAATTGCAGCGGTTGGTTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.90%	26.90%	0.55%	0.61%	NA
All Indica	2759	96.90%	2.90%	0.18%	0.04%	NA
All Japonica	1512	26.40%	71.70%	1.19%	0.73%	NA
Aus	269	98.90%	0.40%	0.74%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	97.80%	1.90%	0.22%	0.00%	NA
Indica III	913	98.60%	1.30%	0.00%	0.11%	NA
Indica Intermediate	786	93.90%	5.70%	0.38%	0.00%	NA
Temperate Japonica	767	40.90%	57.00%	1.96%	0.13%	NA
Tropical Japonica	504	4.40%	93.80%	0.40%	1.39%	NA
Japonica Intermediate	241	26.10%	72.20%	0.41%	1.24%	NA
VI/Aromatic	96	17.70%	69.80%	0.00%	12.50%	NA
Intermediate	90	48.90%	44.40%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219503084	T -> DEL	N	N	silent_mutation	Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1219503084	T -> A	LOC_Os12g32300.1	upstream_gene_variant ; 1994.0bp to feature; MODIFIER	silent_mutation	Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1219503084	T -> A	LOC_Os12g32320.1	upstream_gene_variant ; 2430.0bp to feature; MODIFIER	silent_mutation	Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N
vg1219503084	T -> A	LOC_Os12g32310.1	intron_variant ; MODIFIER	silent_mutation	Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219503084	NA	5.03E-11	mr1084	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	5.26E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	1.24E-11	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	1.65E-13	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	4.84E-14	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	2.70E-15	mr1148_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	5.26E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	2.71E-11	mr1205_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	2.90E-19	mr1239_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	4.40E-08	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	5.64E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	1.07E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	4.97E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	6.22E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	4.03E-14	mr1521_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	1.44E-12	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	3.47E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084	NA	4.59E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251