\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219503084:

Variant ID: vg1219503084 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19503084
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCAACCGCTGCAATTTCCTATCTACCCTAAACAACTCACGGAATTTGGTGAGTTGTCAGCATATTACAATAAGATGTTTGTGGGTAAGTTTTAAAAA[T/A]
TTTCATCTTTATATTATGGGAAAAAAATGACAAATTGTGTTATTAGCAATATGTTGGCTGACACCTTTTTTTTTAGACATTGCTGGTGTTATTGTGTATC

Reverse complement sequence

GATACACAATAACACCAGCAATGTCTAAAAAAAAAGGTGTCAGCCAACATATTGCTAATAACACAATTTGTCATTTTTTTCCCATAATATAAAGATGAAA[A/T]
TTTTTAAAACTTACCCACAAACATCTTATTGTAATATGCTGACAACTCACCAAATTCCGTGAGTTGTTTAGGGTAGATAGGAAATTGCAGCGGTTGGTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 26.90% 0.55% 0.61% NA
All Indica  2759 96.90% 2.90% 0.18% 0.04% NA
All Japonica  1512 26.40% 71.70% 1.19% 0.73% NA
Aus  269 98.90% 0.40% 0.74% 0.00% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 98.60% 1.30% 0.00% 0.11% NA
Indica Intermediate  786 93.90% 5.70% 0.38% 0.00% NA
Temperate Japonica  767 40.90% 57.00% 1.96% 0.13% NA
Tropical Japonica  504 4.40% 93.80% 0.40% 1.39% NA
Japonica Intermediate  241 26.10% 72.20% 0.41% 1.24% NA
VI/Aromatic  96 17.70% 69.80% 0.00% 12.50% NA
Intermediate  90 48.90% 44.40% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219503084 T -> DEL N N silent_mutation Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1219503084 T -> A LOC_Os12g32300.1 upstream_gene_variant ; 1994.0bp to feature; MODIFIER silent_mutation Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1219503084 T -> A LOC_Os12g32320.1 upstream_gene_variant ; 2430.0bp to feature; MODIFIER silent_mutation Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1219503084 T -> A LOC_Os12g32310.1 intron_variant ; MODIFIER silent_mutation Average:44.518; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219503084 NA 5.03E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 5.26E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 1.24E-11 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 1.65E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 4.84E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 2.70E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 5.26E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 2.71E-11 mr1205_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 2.90E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 4.40E-08 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 5.64E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 1.07E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 4.97E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 6.22E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 4.03E-14 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 1.44E-12 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 3.47E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219503084 NA 4.59E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251