\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219448842:

Variant ID: vg1219448842 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19448842
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGAGGTTTTTCAGGAGGACCGGTTACGTACTATTTTTTTTTAAGAATCGGACAGAAATCTTTTTTTCTCACTACTTTTTTCCTTTTTAAAGGAAAAAC[G/A]
GGAACGCACTTTTTTTAAATCGGATAGAAAAAAAATTTGCGCTTGTTTTTTTTGGCACGGATGACGGGATTTTTTTTTTTTAAGAATCGGACAGAATATT

Reverse complement sequence

AATATTCTGTCCGATTCTTAAAAAAAAAAAATCCCGTCATCCGTGCCAAAAAAAACAAGCGCAAATTTTTTTTCTATCCGATTTAAAAAAAGTGCGTTCC[C/T]
GTTTTTCCTTTAAAAAGGAAAAAAGTAGTGAGAAAAAAAGATTTCTGTCCGATTCTTAAAAAAAAATAGTACGTAACCGGTCCTCCTGAAAAACCTCCGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 4.50% 0.28% 0.00% NA
All Indica  2759 92.10% 7.50% 0.47% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.00% 15.10% 0.84% 0.00% NA
Indica II  465 95.10% 4.50% 0.43% 0.00% NA
Indica III  913 96.50% 3.20% 0.33% 0.00% NA
Indica Intermediate  786 91.20% 8.40% 0.38% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219448842 G -> A LOC_Os12g32230.1 upstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 N N N N
vg1219448842 G -> A LOC_Os12g32230.2 upstream_gene_variant ; 3327.0bp to feature; MODIFIER silent_mutation Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 N N N N
vg1219448842 G -> A LOC_Os12g32210.1 downstream_gene_variant ; 1646.0bp to feature; MODIFIER silent_mutation Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 N N N N
vg1219448842 G -> A LOC_Os12g32210-LOC_Os12g32230 intergenic_region ; MODIFIER silent_mutation Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219448842 3.45E-09 1.33E-12 mr1038 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 2.00E-08 1.79E-12 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 1.23E-08 1.77E-12 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 7.45E-08 1.23E-11 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 6.53E-08 5.42E-12 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 1.37E-07 2.37E-11 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 3.02E-10 1.79E-14 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842 1.06E-09 4.32E-14 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251