\
| Variant ID: vg1219448842 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19448842 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACGGAGGTTTTTCAGGAGGACCGGTTACGTACTATTTTTTTTTAAGAATCGGACAGAAATCTTTTTTTCTCACTACTTTTTTCCTTTTTAAAGGAAAAAC[G/A]
GGAACGCACTTTTTTTAAATCGGATAGAAAAAAAATTTGCGCTTGTTTTTTTTGGCACGGATGACGGGATTTTTTTTTTTTAAGAATCGGACAGAATATT
AATATTCTGTCCGATTCTTAAAAAAAAAAAATCCCGTCATCCGTGCCAAAAAAAACAAGCGCAAATTTTTTTTCTATCCGATTTAAAAAAAGTGCGTTCC[C/T]
GTTTTTCCTTTAAAAAGGAAAAAAGTAGTGAGAAAAAAAGATTTCTGTCCGATTCTTAAAAAAAAATAGTACGTAACCGGTCCTCCTGAAAAACCTCCGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.50% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 92.10% | 7.50% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.00% | 15.10% | 0.84% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.50% | 0.43% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 8.40% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219448842 | G -> A | LOC_Os12g32230.1 | upstream_gene_variant ; 3327.0bp to feature; MODIFIER | silent_mutation | Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 | N | N | N | N |
| vg1219448842 | G -> A | LOC_Os12g32230.2 | upstream_gene_variant ; 3327.0bp to feature; MODIFIER | silent_mutation | Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 | N | N | N | N |
| vg1219448842 | G -> A | LOC_Os12g32210.1 | downstream_gene_variant ; 1646.0bp to feature; MODIFIER | silent_mutation | Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 | N | N | N | N |
| vg1219448842 | G -> A | LOC_Os12g32210-LOC_Os12g32230 | intergenic_region ; MODIFIER | silent_mutation | Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219448842 | 3.45E-09 | 1.33E-12 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 2.00E-08 | 1.79E-12 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 1.23E-08 | 1.77E-12 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 7.45E-08 | 1.23E-11 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 6.53E-08 | 5.42E-12 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 1.37E-07 | 2.37E-11 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 3.02E-10 | 1.79E-14 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219448842 | 1.06E-09 | 4.32E-14 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |