Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219448842:

Variant ID: vg1219448842 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19448842
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGGAGGTTTTTCAGGAGGACCGGTTACGTACTATTTTTTTTTAAGAATCGGACAGAAATCTTTTTTTCTCACTACTTTTTTCCTTTTTAAAGGAAAAAC[G/A]
GGAACGCACTTTTTTTAAATCGGATAGAAAAAAAATTTGCGCTTGTTTTTTTTGGCACGGATGACGGGATTTTTTTTTTTTAAGAATCGGACAGAATATT

Reverse complement sequence

AATATTCTGTCCGATTCTTAAAAAAAAAAAATCCCGTCATCCGTGCCAAAAAAAACAAGCGCAAATTTTTTTTCTATCCGATTTAAAAAAAGTGCGTTCC[C/T]
GTTTTTCCTTTAAAAAGGAAAAAAGTAGTGAGAAAAAAAGATTTCTGTCCGATTCTTAAAAAAAAATAGTACGTAACCGGTCCTCCTGAAAAACCTCCGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.30%	4.50%	0.28%	0.00%	NA
All Indica	2759	92.10%	7.50%	0.47%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	84.00%	15.10%	0.84%	0.00%	NA
Indica II	465	95.10%	4.50%	0.43%	0.00%	NA
Indica III	913	96.50%	3.20%	0.33%	0.00%	NA
Indica Intermediate	786	91.20%	8.40%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	4.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219448842	G -> A	LOC_Os12g32230.1	upstream_gene_variant ; 3327.0bp to feature; MODIFIER	silent_mutation	Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619	N	N	N	N
vg1219448842	G -> A	LOC_Os12g32230.2	upstream_gene_variant ; 3327.0bp to feature; MODIFIER	silent_mutation	Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619	N	N	N	N
vg1219448842	G -> A	LOC_Os12g32210.1	downstream_gene_variant ; 1646.0bp to feature; MODIFIER	silent_mutation	Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619	N	N	N	N
vg1219448842	G -> A	LOC_Os12g32210-LOC_Os12g32230	intergenic_region ; MODIFIER	silent_mutation	Average:28.535; most accessible tissue: Minghui63 flower, score: 48.619	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219448842	3.45E-09	1.33E-12	mr1038	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	2.00E-08	1.79E-12	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	1.23E-08	1.77E-12	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	7.45E-08	1.23E-11	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	6.53E-08	5.42E-12	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	1.37E-07	2.37E-11	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	3.02E-10	1.79E-14	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219448842	1.06E-09	4.32E-14	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251