Variant ID: vg1219437084 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 19437084 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCTTCCCACGGAGCACCTCGCCGCCGCCTCAAACGGATCAGCCGCCGCCACACCGCCTCCTCCCACGAAGCAAGTCGCCGCCGACAAAGCAACTCGCCGC[C/T]
AACAAAGCACGAAGCAACTCGCCGCCGCCTCCCACGGATCGGATCAGAAAGGAATGGCTGAGATTTGGTAGAAAACCCTATTTCCCTCCCCGGACACTCA
TGAGTGTCCGGGGAGGGAAATAGGGTTTTCTACCAAATCTCAGCCATTCCTTTCTGATCCGATCCGTGGGAGGCGGCGGCGAGTTGCTTCGTGCTTTGTT[G/A]
GCGGCGAGTTGCTTTGTCGGCGGCGACTTGCTTCGTGGGAGGAGGCGGTGTGGCGGCGGCTGATCCGTTTGAGGCGGCGGCGAGGTGCTCCGTGGGAAGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 94.30% | 5.60% | 0.04% | 0.00% | NA |
All Indica | 2759 | 90.40% | 9.50% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 80.00% | 19.70% | 0.34% | 0.00% | NA |
Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1219437084 | C -> T | LOC_Os12g32210.1 | upstream_gene_variant ; 4092.0bp to feature; MODIFIER | silent_mutation | Average:54.258; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
vg1219437084 | C -> T | LOC_Os12g32210.2 | upstream_gene_variant ; 3634.0bp to feature; MODIFIER | silent_mutation | Average:54.258; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
vg1219437084 | C -> T | LOC_Os12g32200.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.258; most accessible tissue: Zhenshan97 panicle, score: 78.302 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1219437084 | 3.15E-06 | NA | mr1111 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219437084 | NA | 2.37E-06 | mr1111 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219437084 | 8.80E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219437084 | NA | 2.24E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |