\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219410965:

Variant ID: vg1219410965 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19410965
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGAGCACCACGTCTGGTCGTCTCCCTATTGATTGCAGGCATCGAACGGTTCAGACCGCCACCTGAAGTGTCCGATTCCACTAATCAAATTCCGCTGATCG[C/T]
CGCCGTTCTCCACCTTGCGTCCATTTCCATCCCTAGACATCATGTGCGGTCGTCGCGGTGTAAAACACCTCCCCCATACCACTACCAGAATCTCCCGTAG

Reverse complement sequence

CTACGGGAGATTCTGGTAGTGGTATGGGGGAGGTGTTTTACACCGCGACGACCGCACATGATGTCTAGGGATGGAAATGGACGCAAGGTGGAGAACGGCG[G/A]
CGATCAGCGGAATTTGATTAGTGGAATCGGACACTTCAGGTGGCGGTCTGAACCGTTCGATGCCTGCAATCAATAGGGAGACGACCAGACGTGGTGCTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.30% 7.60% 0.08% 0.00% NA
All Indica  2759 87.00% 12.90% 0.14% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 68.70% 30.90% 0.34% 0.00% NA
Indica II  465 93.30% 6.70% 0.00% 0.00% NA
Indica III  913 95.40% 4.60% 0.00% 0.00% NA
Indica Intermediate  786 87.20% 12.60% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219410965 C -> T LOC_Os12g32160.1 upstream_gene_variant ; 2903.0bp to feature; MODIFIER silent_mutation Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg1219410965 C -> T LOC_Os12g32170.1 downstream_gene_variant ; 2986.0bp to feature; MODIFIER silent_mutation Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg1219410965 C -> T LOC_Os12g32160-LOC_Os12g32170 intergenic_region ; MODIFIER silent_mutation Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219410965 NA 2.90E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 5.62E-08 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 1.96E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 2.32E-07 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 6.18E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 2.52E-06 mr1034 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 1.87E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 2.13E-08 mr1052 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 4.45E-09 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965 NA 1.19E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251