Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219410965:

Variant ID: vg1219410965 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19410965
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGAGCACCACGTCTGGTCGTCTCCCTATTGATTGCAGGCATCGAACGGTTCAGACCGCCACCTGAAGTGTCCGATTCCACTAATCAAATTCCGCTGATCG[C/T]
CGCCGTTCTCCACCTTGCGTCCATTTCCATCCCTAGACATCATGTGCGGTCGTCGCGGTGTAAAACACCTCCCCCATACCACTACCAGAATCTCCCGTAG

Reverse complement sequence

CTACGGGAGATTCTGGTAGTGGTATGGGGGAGGTGTTTTACACCGCGACGACCGCACATGATGTCTAGGGATGGAAATGGACGCAAGGTGGAGAACGGCG[G/A]
CGATCAGCGGAATTTGATTAGTGGAATCGGACACTTCAGGTGGCGGTCTGAACCGTTCGATGCCTGCAATCAATAGGGAGACGACCAGACGTGGTGCTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.30%	7.60%	0.08%	0.00%	NA
All Indica	2759	87.00%	12.90%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	68.70%	30.90%	0.34%	0.00%	NA
Indica II	465	93.30%	6.70%	0.00%	0.00%	NA
Indica III	913	95.40%	4.60%	0.00%	0.00%	NA
Indica Intermediate	786	87.20%	12.60%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	1.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219410965	C -> T	LOC_Os12g32160.1	upstream_gene_variant ; 2903.0bp to feature; MODIFIER	silent_mutation	Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg1219410965	C -> T	LOC_Os12g32170.1	downstream_gene_variant ; 2986.0bp to feature; MODIFIER	silent_mutation	Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg1219410965	C -> T	LOC_Os12g32160-LOC_Os12g32170	intergenic_region ; MODIFIER	silent_mutation	Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219410965	NA	2.90E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	5.62E-08	mr1006	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	1.96E-06	mr1007	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	2.32E-07	mr1013	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	6.18E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	2.52E-06	mr1034	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	1.87E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	2.13E-08	mr1052	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	4.45E-09	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219410965	NA	1.19E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251