Variant ID: vg1219410965 (JBrowse) | Variation Type: SNP |
Chromosome: chr12 | Position: 19410965 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGAGCACCACGTCTGGTCGTCTCCCTATTGATTGCAGGCATCGAACGGTTCAGACCGCCACCTGAAGTGTCCGATTCCACTAATCAAATTCCGCTGATCG[C/T]
CGCCGTTCTCCACCTTGCGTCCATTTCCATCCCTAGACATCATGTGCGGTCGTCGCGGTGTAAAACACCTCCCCCATACCACTACCAGAATCTCCCGTAG
CTACGGGAGATTCTGGTAGTGGTATGGGGGAGGTGTTTTACACCGCGACGACCGCACATGATGTCTAGGGATGGAAATGGACGCAAGGTGGAGAACGGCG[G/A]
CGATCAGCGGAATTTGATTAGTGGAATCGGACACTTCAGGTGGCGGTCTGAACCGTTCGATGCCTGCAATCAATAGGGAGACGACCAGACGTGGTGCTCG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 92.30% | 7.60% | 0.08% | 0.00% | NA |
All Indica | 2759 | 87.00% | 12.90% | 0.14% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica I | 595 | 68.70% | 30.90% | 0.34% | 0.00% | NA |
Indica II | 465 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
Indica III | 913 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 87.20% | 12.60% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1219410965 | C -> T | LOC_Os12g32160.1 | upstream_gene_variant ; 2903.0bp to feature; MODIFIER | silent_mutation | Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
vg1219410965 | C -> T | LOC_Os12g32170.1 | downstream_gene_variant ; 2986.0bp to feature; MODIFIER | silent_mutation | Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
vg1219410965 | C -> T | LOC_Os12g32160-LOC_Os12g32170 | intergenic_region ; MODIFIER | silent_mutation | Average:47.391; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1219410965 | NA | 2.90E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 5.62E-08 | mr1006 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 1.96E-06 | mr1007 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 2.32E-07 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 6.18E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 2.52E-06 | mr1034 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 1.87E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 2.13E-08 | mr1052 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 4.45E-09 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1219410965 | NA | 1.19E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |