\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219408917:

Variant ID: vg1219408917 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19408917
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GAGACGCCATAGGAGATCCAAACATGATGACGACACCGAGGCACGATATTTGATAACGGAGTTCAGCCAAGGCCTACATCTCTGGGGCGCTGATTACGGG[C/T]
GCTCCTCCCCGATCCAGCATATTACAGCATATCAAAGTTACAATGACTAACGGCTAGACGCCGCCGGCAGTCGCTCCCTCTCGCTATGCTAAGTCGCCAT

Reverse complement sequence

ATGGCGACTTAGCATAGCGAGAGGGAGCGACTGCCGGCGGCGTCTAGCCGTTAGTCATTGTAACTTTGATATGCTGTAATATGCTGGATCGGGGAGGAGC[G/A]
CCCGTAATCAGCGCCCCAGAGATGTAGGCCTTGGCTGAACTCCGTTATCAAATATCGTGCCTCGGTGTCGTCATCATGTTTGGATCTCCTATGGCGTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 43.20% 0.04% 0.00% NA
All Indica  2759 34.20% 65.70% 0.07% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 36.80% 63.20% 0.00% 0.00% NA
Indica I  595 59.30% 40.50% 0.17% 0.00% NA
Indica II  465 31.60% 68.40% 0.00% 0.00% NA
Indica III  913 20.70% 79.30% 0.00% 0.00% NA
Indica Intermediate  786 32.30% 67.60% 0.13% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219408917 C -> T LOC_Os12g32160.1 upstream_gene_variant ; 855.0bp to feature; MODIFIER silent_mutation Average:45.788; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N
vg1219408917 C -> T LOC_Os12g32160-LOC_Os12g32170 intergenic_region ; MODIFIER silent_mutation Average:45.788; most accessible tissue: Zhenshan97 young leaf, score: 71.497 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219408917 NA 1.39E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 1.79E-10 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 1.78E-10 1.29E-20 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 NA 1.14E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 NA 1.29E-07 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 3.04E-07 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 3.71E-08 1.43E-16 mr1458_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219408917 NA 3.99E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251