\
| Variant ID: vg1219406576 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19406576 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 263. )
TCAATCAAATTGTTCTTTTACATTTACCTTCAGCCATGTTTTCTACTTTATCTTCTACCTAACATTAGTCTGTCTATCCTTCTCGATTTGCACACCACGG[C/T]
GACAATCTGAGCGGCGATCTGCTGCTTGGCTTGCTGCGTGGCGACCAGCTGCGCCCAATGGCCTTGAAGGTGAGGTGGAGGTTGGTGATGACGTCGTTCG
CGAACGACGTCATCACCAACCTCCACCTCACCTTCAAGGCCATTGGGCGCAGCTGGTCGCCACGCAGCAAGCCAAGCAGCAGATCGCCGCTCAGATTGTC[G/A]
CCGTGGTGTGCAAATCGAGAAGGATAGACAGACTAATGTTAGGTAGAAGATAAAGTAGAAAACATGGCTGAAGGTAAATGTAAAAGAACAATTTGATTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 43.30% | 0.13% | 1.84% | NA |
| All Indica | 2759 | 30.80% | 65.80% | 0.22% | 3.12% | NA |
| All Japonica | 1512 | 97.80% | 2.10% | 0.00% | 0.07% | NA |
| Aus | 269 | 36.80% | 63.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.20% | 40.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 14.20% | 68.80% | 0.65% | 16.34% | NA |
| Indica III | 913 | 20.70% | 79.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 31.00% | 67.40% | 0.25% | 1.27% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 5.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219406576 | C -> DEL | LOC_Os12g32160.1 | N | frameshift_variant | Average:47.244; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| vg1219406576 | C -> T | LOC_Os12g32160.1 | synonymous_variant ; p.Ser216Ser; LOW | synonymous_codon | Average:47.244; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219406576 | NA | 2.12E-07 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | 2.01E-11 | NA | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | 1.06E-10 | 8.59E-21 | mr1458 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | NA | 2.46E-06 | mr1686 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | NA | 3.40E-07 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | 1.16E-07 | NA | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | 3.83E-08 | 2.01E-16 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219406576 | NA | 7.59E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |