\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219397316:

Variant ID: vg1219397316 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19397316
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATACTAGAAAATATGGCCGAGCGTTGCAACGGGTGAAAGCTATTTTAATCTTATTATTGTTATACATTTTAGTTAAGGTGAAATTCACTGTGAAAATTAG[C/T]
TTGGATATATATTTTTTAGAAAATCATGAGCTACAATTAGGAGTCCTATTATCTCATATTAGCATGCGAGTTTTCTTGAAGGGATTTCTTATACGACTCC

Reverse complement sequence

GGAGTCGTATAAGAAATCCCTTCAAGAAAACTCGCATGCTAATATGAGATAATAGGACTCCTAATTGTAGCTCATGATTTTCTAAAAAATATATATCCAA[G/A]
CTAATTTTCACAGTGAATTTCACCTTAACTAAAATGTATAACAATAATAAGATTAAAATAGCTTTCACCCGTTGCAACGCTCGGCCATATTTTCTAGTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 5.40% 0.00% 0.00% NA
All Indica  2759 90.90% 9.10% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 79.70% 20.30% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 91.30% 8.70% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219397316 C -> T LOC_Os12g32150.1 upstream_gene_variant ; 4586.0bp to feature; MODIFIER silent_mutation Average:27.04; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N
vg1219397316 C -> T LOC_Os12g32150-LOC_Os12g32160 intergenic_region ; MODIFIER silent_mutation Average:27.04; most accessible tissue: Zhenshan97 young leaf, score: 45.96 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219397316 NA 4.02E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 1.90E-07 mr1006 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 6.54E-06 mr1007 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 2.22E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 6.34E-08 mr1052 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 4.67E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 5.59E-06 mr1006_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 3.85E-06 mr1006_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 6.16E-06 NA mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219397316 NA 4.42E-09 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251