\
| Variant ID: vg1219377796 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19377796 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACGTACCTACCGGCGGCGAGGTCGAGAAGCGGCCAGCGATGATGCAGGTGGCGATGGCGGTTGGGAGGGGAGATCGGTGGCAATGGCGTTTGTATGGAAT[A/G]
CAGTTTTGTTGCAATAGGGTTTGGGGGGAATGGGGAAGGGGATCGAGAGGGAGTGTGGGGTTTTGTGTGGAAATTAATTGGAAAGAAGAAGCAAATTAAA
TTTAATTTGCTTCTTCTTTCCAATTAATTTCCACACAAAACCCCACACTCCCTCTCGATCCCCTTCCCCATTCCCCCCAAACCCTATTGCAACAAAACTG[T/C]
ATTCCATACAAACGCCATTGCCACCGATCTCCCCTCCCAACCGCCATCGCCACCTGCATCATCGCTGGCCGCTTCTCGACCTCGCCGCCGGTAGGTACGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.80% | 4.30% | 0.70% | 21.20% | NA |
| All Indica | 2759 | 65.10% | 2.60% | 0.91% | 31.39% | NA |
| All Japonica | 1512 | 98.50% | 0.90% | 0.07% | 0.60% | NA |
| Aus | 269 | 16.70% | 39.40% | 2.23% | 41.64% | NA |
| Indica I | 595 | 67.60% | 3.70% | 1.18% | 27.56% | NA |
| Indica II | 465 | 30.80% | 1.10% | 1.29% | 66.88% | NA |
| Indica III | 913 | 79.70% | 1.30% | 0.66% | 18.29% | NA |
| Indica Intermediate | 786 | 66.40% | 4.30% | 0.76% | 28.50% | NA |
| Temperate Japonica | 767 | 99.10% | 0.40% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 99.00% | 0.40% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.30% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 92.70% | 4.20% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 78.90% | 6.70% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219377796 | A -> DEL | N | N | silent_mutation | Average:42.677; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1219377796 | A -> G | LOC_Os12g32120.1 | upstream_gene_variant ; 1482.0bp to feature; MODIFIER | silent_mutation | Average:42.677; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1219377796 | A -> G | LOC_Os12g32130.1 | upstream_gene_variant ; 3657.0bp to feature; MODIFIER | silent_mutation | Average:42.677; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| vg1219377796 | A -> G | LOC_Os12g32120-LOC_Os12g32130 | intergenic_region ; MODIFIER | silent_mutation | Average:42.677; most accessible tissue: Zhenshan97 panicle, score: 73.605 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219377796 | NA | 8.43E-09 | mr1060 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | NA | 2.60E-06 | mr1319 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | NA | 7.66E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | NA | 2.67E-06 | mr1444 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | 7.95E-06 | NA | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | NA | 3.01E-08 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | NA | 1.24E-08 | mr1937 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219377796 | NA | 9.92E-08 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |