Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219351662:

Variant ID: vg1219351662 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19351662
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTTGAAGCCGGCCGTGGCGAACCTATCACACACATCGTTCGCTACATTGGCAGAGTAGTGTGTATTTTTTATTATACTTGAAATTTTATATATGTAAAT[C/T]
ATAGATACATAGATTTATCTAGATTAATATGTCCAACATCCATGATTACGTGATGAGGTAAGATGAATAATCTGGTTAGTTGGACTGTGCACAATATGCT

Reverse complement sequence

AGCATATTGTGCACAGTCCAACTAACCAGATTATTCATCTTACCTCATCACGTAATCATGGATGTTGGACATATTAATCTAGATAAATCTATGTATCTAT[G/A]
ATTTACATATATAAAATTTCAAGTATAATAAAAAATACACACTACTCTGCCAATGTAGCGAACGATGTGTGTGATAGGTTCGCCACGGCCGGCTTCAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	1.20%	25.56%	17.58%	NA
All Indica	2759	34.20%	1.40%	38.42%	25.95%	NA
All Japonica	1512	96.70%	0.00%	1.12%	2.18%	NA
Aus	269	28.60%	5.20%	41.26%	24.91%	NA
Indica I	595	29.40%	1.50%	49.75%	19.33%	NA
Indica II	465	20.40%	0.20%	21.29%	58.06%	NA
Indica III	913	44.70%	1.80%	41.62%	11.94%	NA
Indica Intermediate	786	33.70%	1.80%	36.26%	28.24%	NA
Temperate Japonica	767	98.20%	0.00%	0.65%	1.17%	NA
Tropical Japonica	504	97.80%	0.00%	0.60%	1.59%	NA
Japonica Intermediate	241	89.60%	0.00%	3.73%	6.64%	NA
VI/Aromatic	96	86.50%	2.10%	6.25%	5.21%	NA
Intermediate	90	73.30%	0.00%	15.56%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219351662	C -> DEL	N	N	silent_mutation	Average:14.827; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1219351662	C -> T	LOC_Os12g32060.1	downstream_gene_variant ; 4589.0bp to feature; MODIFIER	silent_mutation	Average:14.827; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1219351662	C -> T	LOC_Os12g32080.1	downstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:14.827; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N
vg1219351662	C -> T	LOC_Os12g32060-LOC_Os12g32080	intergenic_region ; MODIFIER	silent_mutation	Average:14.827; most accessible tissue: Minghui63 root, score: 23.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219351662	9.32E-07	NA	mr1987_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219351662	9.18E-06	NA	mr1987_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251