\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219331439:

Variant ID: vg1219331439 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19331439
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CCCTTCACCTCATACAAAATGCCGCTAGATTGCGCCACCTCTCCGTCATCCTTCGTGTCATCCAGAACGCCGCCACCGCTGCCCCTCACCGCTTCGTGTC[A/G]
TCCAGGACAATCACACTCCTAGTACCTCTCTAAGATGATACCCTCAATCAGTTGCAGGGAAAATCTACCAGAGCACCGCTGCCATCGACGCCGCTCACTA

Reverse complement sequence

TAGTGAGCGGCGTCGATGGCAGCGGTGCTCTGGTAGATTTTCCCTGCAACTGATTGAGGGTATCATCTTAGAGAGGTACTAGGAGTGTGATTGTCCTGGA[T/C]
GACACGAAGCGGTGAGGGGCAGCGGTGGCGGCGTTCTGGATGACACGAAGGATGACGGAGAGGTGGCGCAATCTAGCGGCATTTTGTATGAGGTGAAGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 37.30% 0.74% 24.25% NA
All Indica  2759 58.00% 5.80% 1.16% 35.01% NA
All Japonica  1512 2.80% 96.50% 0.07% 0.66% NA
Aus  269 41.60% 2.20% 0.74% 55.39% NA
Indica I  595 53.60% 10.30% 1.01% 35.13% NA
Indica II  465 28.00% 5.40% 2.15% 64.52% NA
Indica III  913 73.60% 2.20% 0.66% 23.55% NA
Indica Intermediate  786 60.90% 7.00% 1.27% 30.79% NA
Temperate Japonica  767 1.60% 98.00% 0.13% 0.26% NA
Tropical Japonica  504 1.80% 97.60% 0.00% 0.60% NA
Japonica Intermediate  241 8.70% 89.20% 0.00% 2.07% NA
VI/Aromatic  96 11.50% 81.20% 0.00% 7.29% NA
Intermediate  90 18.90% 65.60% 0.00% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219331439 A -> DEL N N silent_mutation Average:32.105; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1219331439 A -> G LOC_Os12g32030.1 upstream_gene_variant ; 3596.0bp to feature; MODIFIER silent_mutation Average:32.105; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1219331439 A -> G LOC_Os12g32040.1 downstream_gene_variant ; 1128.0bp to feature; MODIFIER silent_mutation Average:32.105; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N
vg1219331439 A -> G LOC_Os12g32030-LOC_Os12g32040 intergenic_region ; MODIFIER silent_mutation Average:32.105; most accessible tissue: Zhenshan97 panicle, score: 69.946 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219331439 NA 9.65E-109 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 6.81E-107 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 1.83E-70 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 2.74E-06 2.05E-73 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 3.16E-59 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 6.70E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 3.91E-07 NA mr1132 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 2.15E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 8.90E-16 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 8.13E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 8.90E-16 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 4.32E-08 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 2.38E-86 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 5.72E-86 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 2.44E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 1.50E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 5.18E-86 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 1.44E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 5.71E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 1.65E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 1.21E-14 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 4.50E-102 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219331439 NA 1.08E-14 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251