\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219227024:

Variant ID: vg1219227024 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19227024
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, T: 0.37, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


CGGCGGTAGCGCCCTCCCCTTTACTCCTCTCCCCAGTTGTAGATTTTTTTGTTGATGTTTGTGTGAATTTGTTGATGAATTTGTTGTTGAATATGTTCAT[G/T]
CTGTGATTCAATTTGATTCAATTTATTTTGGTGATGATTTGTTGATGATTTTGGGGTTTGAGGCGCATACCCGGTGACTGCTCCGCTTGGTGAGTTCGGC

Reverse complement sequence

GCCGAACTCACCAAGCGGAGCAGTCACCGGGTATGCGCCTCAAACCCCAAAATCATCAACAAATCATCACCAAAATAAATTGAATCAAATTGAATCACAG[C/A]
ATGAACATATTCAACAACAAATTCATCAACAAATTCACACAAACATCAACAAAAAAATCTACAACTGGGGAGAGGAGTAAAGGGGAGGGCGCTACCGCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.00% 26.90% 2.92% 34.15% NA
All Indica  2759 3.60% 44.10% 4.60% 47.73% NA
All Japonica  1512 96.60% 0.50% 0.13% 2.84% NA
Aus  269 1.90% 13.40% 1.86% 82.90% NA
Indica I  595 3.00% 33.90% 5.04% 57.98% NA
Indica II  465 2.80% 53.30% 5.38% 38.49% NA
Indica III  913 1.80% 46.50% 4.27% 47.43% NA
Indica Intermediate  786 6.60% 43.40% 4.20% 45.80% NA
Temperate Japonica  767 98.30% 0.30% 0.26% 1.17% NA
Tropical Japonica  504 97.60% 0.00% 0.00% 2.38% NA
Japonica Intermediate  241 88.80% 2.10% 0.00% 9.13% NA
VI/Aromatic  96 84.40% 3.10% 0.00% 12.50% NA
Intermediate  90 64.40% 10.00% 4.44% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219227024 G -> DEL N N silent_mutation Average:35.653; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1219227024 G -> T LOC_Os12g31910.1 upstream_gene_variant ; 1282.0bp to feature; MODIFIER silent_mutation Average:35.653; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg1219227024 G -> T LOC_Os12g31900-LOC_Os12g31910 intergenic_region ; MODIFIER silent_mutation Average:35.653; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219227024 NA 1.38E-06 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 1.65E-06 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 1.18E-06 mr1251 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 4.19E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 9.22E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 3.24E-10 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 2.82E-12 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 1.30E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 1.35E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 4.59E-09 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 1.79E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 3.76E-06 3.15E-23 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 1.67E-06 3.94E-11 mr1255_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 1.48E-12 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 3.33E-06 mr1423_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219227024 NA 5.50E-09 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251