\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219215446:

Variant ID: vg1219215446 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19215446
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCAGCTATCAACTTACTTAGCTTAAACTTCTGACAAAACAACTTCCTTCCAAGTACATTCAGGGCCAGTGGTCTTAATTAGAAAGTATAAGATTACAT[A/C]
GAAGCCTTCCCCTGTTCTATCATAATTAAATAAGTGACAATCCGACCACAGCTCTTTTCCAGATATATTCAAGTCGAGGCCGGGTTTATGTTCATTTCCT

Reverse complement sequence

AGGAAATGAACATAAACCCGGCCTCGACTTGAATATATCTGGAAAAGAGCTGTGGTCGGATTGTCACTTATTTAATTATGATAGAACAGGGGAAGGCTTC[T/G]
ATGTAATCTTATACTTTCTAATTAAGACCACTGGCCCTGAATGTACTTGGAAGGAAGTTGTTTTGTCAGAAGTTTAAGCTAAGTAAGTTGATAGCTGAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.80% 0.40% 1.48% 55.37% NA
All Indica  2759 13.60% 0.60% 1.99% 83.87% NA
All Japonica  1512 96.70% 0.00% 0.07% 3.24% NA
Aus  269 14.90% 0.70% 3.72% 80.67% NA
Indica I  595 7.10% 0.00% 5.21% 87.73% NA
Indica II  465 20.90% 1.10% 0.00% 78.06% NA
Indica III  913 12.90% 0.50% 0.88% 85.65% NA
Indica Intermediate  786 14.90% 0.80% 2.04% 82.32% NA
Temperate Japonica  767 98.30% 0.00% 0.00% 1.69% NA
Tropical Japonica  504 97.60% 0.00% 0.00% 2.38% NA
Japonica Intermediate  241 89.60% 0.00% 0.41% 9.96% NA
VI/Aromatic  96 87.50% 0.00% 1.04% 11.46% NA
Intermediate  90 67.80% 0.00% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219215446 A -> C LOC_Os12g31900.1 upstream_gene_variant ; 1678.0bp to feature; MODIFIER silent_mutation Average:29.522; most accessible tissue: Callus, score: 72.145 N N N N
vg1219215446 A -> C LOC_Os12g31900-LOC_Os12g31910 intergenic_region ; MODIFIER silent_mutation Average:29.522; most accessible tissue: Callus, score: 72.145 N N N N
vg1219215446 A -> DEL N N silent_mutation Average:29.522; most accessible tissue: Callus, score: 72.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219215446 NA 2.06E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 4.74E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 2.68E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 1.84E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 8.68E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 2.92E-06 2.92E-06 mr1366 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 1.83E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 9.46E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 9.03E-06 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 2.99E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 7.99E-06 mr1564 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 8.71E-07 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 3.04E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 4.60E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 2.25E-06 mr1898 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219215446 NA 1.30E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251