\
| Variant ID: vg1219203688 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19203688 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )
AAGATCGTTAGGATAATTTCAGTTATCAACAACTAAATAGAAAAAGCCTAACATACATTTTCTCCACCAGATAACCGGGGAGAGCCCCAAGGAGAAGACC[T/C]
GGTTGTATGGACGCCATTTTGATGAGAGCAATGAGCTGATCAGCCAAATCTCAAGGAGATCCATTGATGTCCTCAAAGAGTACTATCGAGTAAGATACAT
ATGTATCTTACTCGATAGTACTCTTTGAGGACATCAATGGATCTCCTTGAGATTTGGCTGATCAGCTCATTGCTCTCATCAAAATGGCGTCCATACAACC[A/G]
GGTCTTCTCCTTGGGGCTCTCCCCGGTTATCTGGTGGAGAAAATGTATGTTAGGCTTTTTCTATTTAGTTGTTGATAACTGAAATTATCCTAACGATCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.80% | 36.00% | 1.35% | 23.85% | NA |
| All Indica | 2759 | 53.70% | 3.70% | 2.28% | 40.34% | NA |
| All Japonica | 1512 | 3.10% | 96.60% | 0.00% | 0.33% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 48.60% | 3.00% | 1.51% | 46.89% | NA |
| Indica II | 465 | 77.00% | 2.40% | 1.72% | 18.92% | NA |
| Indica III | 913 | 44.90% | 2.20% | 2.30% | 50.60% | NA |
| Indica Intermediate | 786 | 54.10% | 6.60% | 3.18% | 36.13% | NA |
| Temperate Japonica | 767 | 1.30% | 98.30% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 2.20% | 97.60% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 10.80% | 88.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 14.60% | 84.40% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 25.60% | 65.60% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219203688 | T -> C | LOC_Os12g31880.1 | missense_variant ; p.Trp470Arg; MODERATE | nonsynonymous_codon ; W470R | Average:47.645; most accessible tissue: Callus, score: 87.713 | benign |
-0.338 |
TOLERATED | 0.32 |
| vg1219203688 | T -> DEL | LOC_Os12g31880.1 | N | frameshift_variant | Average:47.645; most accessible tissue: Callus, score: 87.713 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219203688 | NA | 2.11E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 3.09E-71 | mr1018 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 8.99E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 1.64E-29 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 1.40E-33 | mr1350 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 5.49E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 3.95E-11 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 7.13E-36 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 5.18E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | 1.60E-07 | 4.07E-42 | mr1719 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | 3.03E-06 | 4.23E-07 | mr1719 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 4.58E-19 | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 3.67E-12 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 1.19E-33 | mr1944 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219203688 | NA | 9.13E-16 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |