\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219202589:

Variant ID: vg1219202589 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19202589
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.76, A: 0.24, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTAACTTTATCTTTTCAGGGACTGAAATATGCAATTCCAGGCACTTCTCTCGTTGTAGTGAAGCCAGGGGATGATCTGGGACAATCTGAAGCCAAAA[G/A]
CCAGAGGAATGAGAATGAAGAGGGAAATGTAATACAAGAAATAAGTAGGCTCAAAACTTGCAAGGAAGGTGTCTATGTGCAAGCTTCTACTTTTGGAATC

Reverse complement sequence

GATTCCAAAAGTAGAAGCTTGCACATAGACACCTTCCTTGCAAGTTTTGAGCCTACTTATTTCTTGTATTACATTTCCCTCTTCATTCTCATTCCTCTGG[C/T]
TTTTGGCTTCAGATTGTCCCAGATCATCCCCTGGCTTCACTACAACGAGAGAAGTGCCTGGAATTGCATATTTCAGTCCCTGAAAAGATAAAGTTAAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 26.20% 0.57% 24.80% NA
All Indica  2759 22.90% 34.20% 0.98% 41.94% NA
All Japonica  1512 97.10% 2.60% 0.00% 0.33% NA
Aus  269 14.10% 85.50% 0.00% 0.37% NA
Indica I  595 4.40% 47.10% 1.51% 47.06% NA
Indica II  465 52.30% 27.30% 0.43% 20.00% NA
Indica III  913 17.20% 30.00% 0.44% 52.35% NA
Indica Intermediate  786 26.10% 33.50% 1.53% 38.93% NA
Temperate Japonica  767 98.80% 0.80% 0.00% 0.39% NA
Tropical Japonica  504 98.00% 1.80% 0.00% 0.20% NA
Japonica Intermediate  241 89.60% 10.00% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 10.40% 0.00% 1.04% NA
Intermediate  90 73.30% 17.80% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219202589 G -> DEL LOC_Os12g31880.1 N frameshift_variant Average:39.84; most accessible tissue: Minghui63 young leaf, score: 79.896 N N N N
vg1219202589 G -> A LOC_Os12g31880.1 missense_variant ; p.Ser252Asn; MODERATE nonsynonymous_codon ; S252N Average:39.84; most accessible tissue: Minghui63 young leaf, score: 79.896 unknown unknown TOLERATED 0.40

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219202589 NA 1.35E-14 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.61E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.98E-10 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 4.83E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 2.84E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.40E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 3.33E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.03E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 5.69E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 2.45E-22 mr1195_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 2.75E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 3.61E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 5.30E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.55E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.61E-08 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 5.04E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 2.61E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 7.48E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 4.41E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.04E-06 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 2.99E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219202589 NA 1.39E-10 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251