\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219191852:

Variant ID: vg1219191852 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19191852
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, A: 0.22, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTTCGTTTCAAAACTTATAATTATAACTAAATGCAGGGCCAAAGACCAACATAAAATTTTGCTGAAGTCCTGTTTGAAATACTTTGATTTTGTGGGA[A/C]
TTTTGCAAGAAATAATTTAATCCCAGCGAAATTCCTCTAAAACCCTTACGACTCCTTTGGAATATATGGAGGATACTCTTAGGGAAAACCTATAAAAAAT

Reverse complement sequence

ATTTTTTATAGGTTTTCCCTAAGAGTATCCTCCATATATTCCAAAGGAGTCGTAAGGGTTTTAGAGGAATTTCGCTGGGATTAAATTATTTCTTGCAAAA[T/G]
TCCCACAAAATCAAAGTATTTCAAACAGGACTTCAGCAAAATTTTATGTTGGTCTTTGGCCCTGCATTTAGTTATAATTATAAGTTTTGAAACGAACTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.80% 49.10% 0.15% 0.00% NA
All Indica  2759 26.00% 73.80% 0.25% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 14.10% 85.90% 0.00% 0.00% NA
Indica I  595 35.10% 64.50% 0.34% 0.00% NA
Indica II  465 11.00% 89.00% 0.00% 0.00% NA
Indica III  913 26.30% 73.70% 0.00% 0.00% NA
Indica Intermediate  786 27.60% 71.80% 0.64% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219191852 A -> C LOC_Os12g31870.1 downstream_gene_variant ; 1788.0bp to feature; MODIFIER silent_mutation Average:69.043; most accessible tissue: Minghui63 root, score: 94.097 N N N N
vg1219191852 A -> C LOC_Os12g31860-LOC_Os12g31870 intergenic_region ; MODIFIER silent_mutation Average:69.043; most accessible tissue: Minghui63 root, score: 94.097 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219191852 A C -0.01 -0.01 -0.02 0.0 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219191852 NA 6.03E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 9.27E-07 mr1100 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 6.87E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 6.38E-07 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 7.12E-08 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 6.67E-15 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 1.43E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 4.25E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 5.93E-06 mr1294_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 2.81E-06 mr1299_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 1.88E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 5.46E-19 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 7.25E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 6.90E-06 mr1642_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 5.41E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 4.37E-06 mr1700_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 2.55E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 3.60E-06 mr1823_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 4.06E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 2.75E-06 mr1856_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 6.79E-06 mr1894_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219191852 NA 7.28E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251