\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219189600:

Variant ID: vg1219189600 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19189600
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGTTTAAGAAAAGCACCATTTAGTAACATGGAAAGCGTGGAGCGTGCAAACGAAAATTCAAAAGATGGAATCAGGGAAAAATAGGGCCTTAAACTCCC[T/C]
TATAACACTCTTATCCTATCAAGAGTTCTATTGATATTCGTTAATATTGTGCTCACAATTATAACATAATAATTTCTTTCAACCATACGAACAAATAATA

Reverse complement sequence

TATTATTTGTTCGTATGGTTGAAAGAAATTATTATGTTATAATTGTGAGCACAATATTAACGAATATCAATAGAACTCTTGATAGGATAAGAGTGTTATA[A/G]
GGGAGTTTAAGGCCCTATTTTTCCCTGATTCCATCTTTTGAATTTTCGTTTGCACGCTCCACGCTTTCCATGTTACTAAATGGTGCTTTTCTTAAACAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 12.30% 0.08% 0.00% NA
All Indica  2759 82.30% 17.60% 0.14% 0.00% NA
All Japonica  1512 94.40% 5.60% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 77.30% 22.50% 0.17% 0.00% NA
Indica II  465 94.80% 4.90% 0.22% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 79.50% 20.40% 0.13% 0.00% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 75.10% 24.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219189600 T -> C LOC_Os12g31860.1 upstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31860.3 upstream_gene_variant ; 3915.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31860.2 upstream_gene_variant ; 3868.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31860.5 upstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31860.4 upstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31860.6 upstream_gene_variant ; 3683.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31870.1 downstream_gene_variant ; 4040.0bp to feature; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg1219189600 T -> C LOC_Os12g31860-LOC_Os12g31870 intergenic_region ; MODIFIER silent_mutation Average:31.502; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219189600 NA 1.00E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 8.78E-10 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.79E-08 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.64E-09 mr1043 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.47E-08 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.10E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.37E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 5.45E-07 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 6.45E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 3.89E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.15E-06 mr1189 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 3.92E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.86E-08 mr1479 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 5.11E-08 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.13E-06 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 5.36E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 3.76E-07 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.69E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.93E-06 mr1625 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 4.85E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 7.48E-07 mr1660 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 8.68E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 2.38E-06 mr1684 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 5.58E-07 mr1698 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 7.83E-06 mr1734 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.91E-08 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 3.61E-07 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.77E-09 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 6.21E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.73E-08 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219189600 NA 1.00E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251