\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219176458:

Variant ID: vg1219176458 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19176458
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTCTTTCATATCATTTGATTCATTGTTAAATATATTTTTATATACGTATATAATTTTACATATTTCACAAAAGTTTTTAATAAAACGAACGGTCAAA[C/T]
ATGTGCTAAAAAGTCAACGGCGTCAAACATTTCGAAACGGAGGGAGTATACATTTAGATTTTCAGGTGGCGGGCATTGGGTGAAGATCACGGTAGGTACG

Reverse complement sequence

CGTACCTACCGTGATCTTCACCCAATGCCCGCCACCTGAAAATCTAAATGTATACTCCCTCCGTTTCGAAATGTTTGACGCCGTTGACTTTTTAGCACAT[G/A]
TTTGACCGTTCGTTTTATTAAAAACTTTTGTGAAATATGTAAAATTATATACGTATATAAAAATATATTTAACAATGAATCAAATGATATGAAAGAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 8.80% 0.63% 43.27% NA
All Indica  2759 18.90% 9.90% 1.01% 70.21% NA
All Japonica  1512 93.10% 5.60% 0.07% 1.26% NA
Aus  269 59.50% 18.60% 0.00% 21.93% NA
Indica I  595 6.90% 19.70% 1.34% 72.10% NA
Indica II  465 37.00% 3.00% 0.00% 60.00% NA
Indica III  913 15.40% 8.10% 1.20% 75.25% NA
Indica Intermediate  786 21.40% 8.50% 1.15% 68.96% NA
Temperate Japonica  767 98.30% 0.80% 0.00% 0.91% NA
Tropical Japonica  504 94.80% 4.60% 0.00% 0.60% NA
Japonica Intermediate  241 73.00% 22.80% 0.41% 3.73% NA
VI/Aromatic  96 87.50% 2.10% 1.04% 9.38% NA
Intermediate  90 67.80% 8.90% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219176458 C -> DEL N N silent_mutation Average:41.145; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1219176458 C -> T LOC_Os12g31860.1 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:41.145; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1219176458 C -> T LOC_Os12g31860.3 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:41.145; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1219176458 C -> T LOC_Os12g31860.2 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:41.145; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1219176458 C -> T LOC_Os12g31860.5 downstream_gene_variant ; 4176.0bp to feature; MODIFIER silent_mutation Average:41.145; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1219176458 C -> T LOC_Os12g31850-LOC_Os12g31860 intergenic_region ; MODIFIER silent_mutation Average:41.145; most accessible tissue: Minghui63 root, score: 76.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219176458 NA 3.92E-07 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 4.38E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 6.03E-06 3.57E-08 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 1.02E-07 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 2.85E-06 2.84E-06 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 5.67E-07 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 8.78E-08 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 5.38E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 2.51E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 9.47E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 1.52E-07 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 2.69E-06 mr1823_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 9.65E-06 mr1831_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 3.89E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 2.86E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458 NA 1.81E-07 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251