Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219176458:

Variant ID: vg1219176458 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19176458
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTCTTTCATATCATTTGATTCATTGTTAAATATATTTTTATATACGTATATAATTTTACATATTTCACAAAAGTTTTTAATAAAACGAACGGTCAAA[C/T]
ATGTGCTAAAAAGTCAACGGCGTCAAACATTTCGAAACGGAGGGAGTATACATTTAGATTTTCAGGTGGCGGGCATTGGGTGAAGATCACGGTAGGTACG

Reverse complement sequence

CGTACCTACCGTGATCTTCACCCAATGCCCGCCACCTGAAAATCTAAATGTATACTCCCTCCGTTTCGAAATGTTTGACGCCGTTGACTTTTTAGCACAT[G/A]
TTTGACCGTTCGTTTTATTAAAAACTTTTGTGAAATATGTAAAATTATATACGTATATAAAAATATATTTAACAATGAATCAAATGATATGAAAGAATTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.30%	8.80%	0.63%	43.27%	NA
All Indica	2759	18.90%	9.90%	1.01%	70.21%	NA
All Japonica	1512	93.10%	5.60%	0.07%	1.26%	NA
Aus	269	59.50%	18.60%	0.00%	21.93%	NA
Indica I	595	6.90%	19.70%	1.34%	72.10%	NA
Indica II	465	37.00%	3.00%	0.00%	60.00%	NA
Indica III	913	15.40%	8.10%	1.20%	75.25%	NA
Indica Intermediate	786	21.40%	8.50%	1.15%	68.96%	NA
Temperate Japonica	767	98.30%	0.80%	0.00%	0.91%	NA
Tropical Japonica	504	94.80%	4.60%	0.00%	0.60%	NA
Japonica Intermediate	241	73.00%	22.80%	0.41%	3.73%	NA
VI/Aromatic	96	87.50%	2.10%	1.04%	9.38%	NA
Intermediate	90	67.80%	8.90%	0.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219176458	C -> DEL	N	N	silent_mutation	Average:41.145; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1219176458	C -> T	LOC_Os12g31860.1	downstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:41.145; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1219176458	C -> T	LOC_Os12g31860.3	downstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:41.145; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1219176458	C -> T	LOC_Os12g31860.2	downstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:41.145; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1219176458	C -> T	LOC_Os12g31860.5	downstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:41.145; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1219176458	C -> T	LOC_Os12g31850-LOC_Os12g31860	intergenic_region ; MODIFIER	silent_mutation	Average:41.145; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219176458	NA	3.92E-07	mr1041_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	4.38E-07	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	6.03E-06	3.57E-08	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	1.02E-07	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	2.85E-06	2.84E-06	mr1412_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	5.67E-07	mr1494_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	8.78E-08	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	5.38E-07	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	2.51E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	9.47E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	1.52E-07	mr1814_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	2.69E-06	mr1823_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	9.65E-06	mr1831_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	3.89E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	2.86E-06	mr1856_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219176458	NA	1.81E-07	mr1894_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251