\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219164957:

Variant ID: vg1219164957 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19164957
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.06, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAAGAAATCAGGAAATCAAATTCATTCCAACAGCCATAGGGAAGATCCCAAATTGTGGATAAGCTATCCTTATCACTTATCAGCATGAAAGACTCCCA[G/A]
TTCTTGGAACCCTAAATCCCCAATTCTTCAAAGATCAGATTCTGCTGAGGATGAGAAGAGATCCAAACTCCCAATTAAACACATAAACACACAAGGAAGG

Reverse complement sequence

CCTTCCTTGTGTGTTTATGTGTTTAATTGGGAGTTTGGATCTCTTCTCATCCTCAGCAGAATCTGATCTTTGAAGAATTGGGGATTTAGGGTTCCAAGAA[C/T]
TGGGAGTCTTTCATGCTGATAAGTGATAAGGATAGCTTATCCACAATTTGGGATCTTCCCTATGGCTGTTGGAATGAATTTGATTTCCTGATTTCTTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 19.80% 0.02% 0.00% NA
All Indica  2759 74.20% 25.70% 0.04% 0.00% NA
All Japonica  1512 93.70% 6.30% 0.00% 0.00% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 70.40% 29.60% 0.00% 0.00% NA
Indica II  465 92.00% 8.00% 0.00% 0.00% NA
Indica III  913 67.00% 33.00% 0.00% 0.00% NA
Indica Intermediate  786 74.90% 24.90% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219164957 G -> A LOC_Os12g31850.2 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:81.267; most accessible tissue: Zhenshan97 flower, score: 94.648 N N N N
vg1219164957 G -> A LOC_Os12g31850.2 5_prime_UTR_variant ; 391.0bp to feature; MODIFIER silent_mutation Average:81.267; most accessible tissue: Zhenshan97 flower, score: 94.648 N N N N
vg1219164957 G -> A LOC_Os12g31840.1 downstream_gene_variant ; 3326.0bp to feature; MODIFIER silent_mutation Average:81.267; most accessible tissue: Zhenshan97 flower, score: 94.648 N N N N
vg1219164957 G -> A LOC_Os12g31850.1 intron_variant ; MODIFIER silent_mutation Average:81.267; most accessible tissue: Zhenshan97 flower, score: 94.648 N N N N
vg1219164957 G -> A LOC_Os12g31850.3 intron_variant ; MODIFIER silent_mutation Average:81.267; most accessible tissue: Zhenshan97 flower, score: 94.648 N N N N
vg1219164957 G -> A LOC_Os12g31850.4 intron_variant ; MODIFIER silent_mutation Average:81.267; most accessible tissue: Zhenshan97 flower, score: 94.648 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219164957 G A 0.0 0.0 0.0 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219164957 NA 6.82E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 1.11E-06 mr1029 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 7.67E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 1.11E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 5.38E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 4.04E-07 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 1.02E-06 mr1171 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 1.98E-06 mr1189 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 1.18E-06 5.72E-08 mr1339 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 8.31E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 5.93E-06 1.70E-06 mr1413 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 4.95E-06 4.94E-06 mr1413 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 4.27E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 7.83E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 8.72E-07 mr1485 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 6.68E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 7.97E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 2.38E-08 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 5.65E-08 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 1.43E-07 mr1642 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 5.63E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 8.68E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 1.59E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 2.96E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 3.78E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 6.50E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219164957 NA 3.25E-06 mr1981 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251