\
| Variant ID: vg1219157807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19157807 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 119. )
AAAGATTTTATGGAATGCCAAATTTTGTTTAAAAGGTAAAAATTTCTCCTTCGCCAATATACGAAGGGCCTCATTGTTTGGCTGATGCTTATGCTTATAA[G/A]
CTAAAATTTAAATTTTAGAACTTGATTTTGAATTTATTTTTTTTTCGTTTTTCATCGTAGTTTATTTTACAACATCTGTTTTTATTTAGTCGCTAAAGAG
CTCTTTAGCGACTAAATAAAAACAGATGTTGTAAAATAAACTACGATGAAAAACGAAAAAAAAATAAATTCAAAATCAAGTTCTAAAATTTAAATTTTAG[C/T]
TTATAAGCATAAGCATCAGCCAAACAATGAGGCCCTTCGTATATTGGCGAAGGAGAAATTTTTACCTTTTAAACAAAATTTGGCATTCCATAAAATCTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 35.60% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 39.90% | 59.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 33.80% | 66.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 24.10% | 75.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 49.00% | 50.60% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 43.50% | 56.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219157807 | G -> A | LOC_Os12g31840.1 | upstream_gene_variant ; 290.0bp to feature; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| vg1219157807 | G -> A | LOC_Os12g31830.1 | downstream_gene_variant ; 1600.0bp to feature; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| vg1219157807 | G -> A | LOC_Os12g31850.1 | downstream_gene_variant ; 3927.0bp to feature; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| vg1219157807 | G -> A | LOC_Os12g31850.3 | downstream_gene_variant ; 3927.0bp to feature; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| vg1219157807 | G -> A | LOC_Os12g31850.2 | downstream_gene_variant ; 3927.0bp to feature; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| vg1219157807 | G -> A | LOC_Os12g31850.4 | downstream_gene_variant ; 3927.0bp to feature; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| vg1219157807 | G -> A | LOC_Os12g31830-LOC_Os12g31840 | intergenic_region ; MODIFIER | silent_mutation | Average:61.621; most accessible tissue: Callus, score: 88.879 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219157807 | NA | 4.39E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 4.28E-07 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 8.83E-06 | mr1029 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 5.99E-06 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.35E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 7.52E-07 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.18E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.02E-07 | mr1093 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 5.74E-07 | mr1094 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 3.10E-06 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 5.49E-07 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.08E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.04E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 4.82E-06 | mr1157 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.94E-12 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 7.54E-06 | mr1181 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.16E-06 | mr1193 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 7.40E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 3.51E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | 4.93E-06 | 4.93E-06 | mr1374 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.18E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 4.72E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | 2.13E-06 | 2.13E-06 | mr1413 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.55E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | 8.93E-06 | 3.51E-07 | mr1446 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.98E-43 | mr1458 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 5.47E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 8.92E-09 | mr1518 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 4.38E-18 | mr1552 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.87E-06 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | 1.97E-07 | 3.19E-10 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.65E-07 | mr1642 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 7.07E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 1.40E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.54E-06 | mr1768 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.11E-06 | mr1981 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 5.22E-08 | mr1981 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 2.82E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 6.01E-06 | mr1989 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 6.55E-06 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 6.04E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 3.01E-06 | mr1642_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219157807 | NA | 4.00E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |