Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219131671:

Variant ID: vg1219131671 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 19131671
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTGATGTTATTATTTTAGTAACGTTGAGATAGTCCAGCTTGGGATGTTCCTATTGAGATTTCCACTTGCAAGTGGTGCAATTTTTAAAACCATTCCAT[C/T]
GTTCTTGAGATATGAGATGGAATGATATTGAAGTTAATTGCTATATGAGATGTCTGATTTAGTTGTTAGATGTATGGCATTGCTTTCTTCTGTAAATTGG

Reverse complement sequence

CCAATTTACAGAAGAAAGCAATGCCATACATCTAACAACTAAATCAGACATCTCATATAGCAATTAACTTCAATATCATTCCATCTCATATCTCAAGAAC[G/A]
ATGGAATGGTTTTAAAAATTGCACCACTTGCAAGTGGAAATCTCAATAGGAACATCCCAAGCTGGACTATCTCAACGTTACTAAAATAATAACATCAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.00% 0.70% 0.30% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 97.20% 1.90% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 95.30% 3.40% 1.30% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219131671 C -> T LOC_Os12g31790.1 upstream_gene_variant ; 1959.0bp to feature; MODIFIER silent_mutation Average:45.779; most accessible tissue: Minghui63 root, score: 59.105 N N N N
vg1219131671 C -> T LOC_Os12g31800.1 intron_variant ; MODIFIER silent_mutation Average:45.779; most accessible tissue: Minghui63 root, score: 59.105 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219131671 NA 6.02E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 1.21E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 3.69E-06 3.69E-06 mr1004_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 8.83E-06 mr1030_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 6.56E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 8.67E-06 mr1358_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 2.42E-07 mr1458_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 1.10E-06 4.79E-09 mr1563_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 7.28E-06 mr1735_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 2.31E-06 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219131671 NA 7.29E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251