Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219126930:

Variant ID: vg1219126930 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19126930
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TAATAATATACTAGCGTAAAGCCATAAATGCCAATTTACTGCTTCAGATTTGCAGCCATTGACTACAACATATTTTTATATTTGTAATGATAAAAATGTT[A/C]
AGAACCATGAATCTTACATGGTGGCTTATTATCAACATACATACAATTTAACAATTGTATTTTAGCAAAGTAAATATGGACAGCAATGACAGCACACTTC

Reverse complement sequence

GAAGTGTGCTGTCATTGCTGTCCATATTTACTTTGCTAAAATACAATTGTTAAATTGTATGTATGTTGATAATAAGCCACCATGTAAGATTCATGGTTCT[T/G]
AACATTTTTATCATTACAAATATAAAAATATGTTGTAGTCAATGGCTGCAAATCTGAAGCAGTAAATTGGCATTTATGGCTTTACGCTAGTATATTATTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	12.10%	0.04%	0.00%	NA
All Indica	2759	89.10%	10.80%	0.07%	0.00%	NA
All Japonica	1512	94.20%	5.80%	0.00%	0.00%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	84.00%	15.60%	0.34%	0.00%	NA
Indica II	465	95.70%	4.30%	0.00%	0.00%	NA
Indica III	913	88.90%	11.10%	0.00%	0.00%	NA
Indica Intermediate	786	89.20%	10.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	95.40%	4.60%	0.00%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219126930	A -> C	LOC_Os12g31780.1	upstream_gene_variant ; 3537.0bp to feature; MODIFIER	silent_mutation	Average:40.988; most accessible tissue: Callus, score: 64.264	N	N	N	N
vg1219126930	A -> C	LOC_Os12g31800.1	upstream_gene_variant ; 2994.0bp to feature; MODIFIER	silent_mutation	Average:40.988; most accessible tissue: Callus, score: 64.264	N	N	N	N
vg1219126930	A -> C	LOC_Os12g31780.2	upstream_gene_variant ; 2535.0bp to feature; MODIFIER	silent_mutation	Average:40.988; most accessible tissue: Callus, score: 64.264	N	N	N	N
vg1219126930	A -> C	LOC_Os12g31770.1	downstream_gene_variant ; 4353.0bp to feature; MODIFIER	silent_mutation	Average:40.988; most accessible tissue: Callus, score: 64.264	N	N	N	N
vg1219126930	A -> C	LOC_Os12g31790.1	intron_variant ; MODIFIER	silent_mutation	Average:40.988; most accessible tissue: Callus, score: 64.264	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219126930	NA	7.09E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	9.96E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	7.59E-06	mr1485	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	9.11E-07	NA	mr1588	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	8.87E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	2.18E-06	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	1.74E-06	mr1294_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	9.38E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	3.71E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219126930	NA	5.58E-06	mr1814_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251