Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219115124:

Variant ID: vg1219115124 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 19115124
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TATATCTACTGCTTTTGTTATTTTGTACGTATTGTATGGAAAATGCAGCAGGAGTAGTGATAGTGACGTACGTGGTGTGGGAGGAGGCGTAGTGGAAGAG[G/A]
TTGCCCTTGGCGGAGAAGACGATGGCGGCGACGTCGACGTCGCAGAGGACGGCGATCTCGTGGGCCTTCTTGAGCAGCCCCGGCCGCCGCTTGGAGAAGG

Reverse complement sequence

CCTTCTCCAAGCGGCGGCCGGGGCTGCTCAAGAAGGCCCACGAGATCGCCGTCCTCTGCGACGTCGACGTCGCCGCCATCGTCTTCTCCGCCAAGGGCAA[C/T]
CTCTTCCACTACGCCTCCTCCCACACCACGTACGTCACTATCACTACTCCTGCTGCATTTTCCATACAATACGTACAAAATAACAAAAGCAGTAGATATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.40%	41.50%	0.19%	0.00%	NA
All Indica	2759	30.20%	69.50%	0.25%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.40%	0.37%	0.00%	NA
Indica I	595	17.50%	82.00%	0.50%	0.00%	NA
Indica II	465	37.00%	63.00%	0.00%	0.00%	NA
Indica III	913	31.70%	68.10%	0.22%	0.00%	NA
Indica Intermediate	786	34.20%	65.50%	0.25%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	97.10%	2.50%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	75.60%	24.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1219115124	G -> A	LOC_Os12g31748.2	synonymous_variant ; p.Asn53Asn; LOW	synonymous_codon	Average:80.453; most accessible tissue: Minghui63 root, score: 89.526	N	N	N	N
vg1219115124	G -> A	LOC_Os12g31748.1	synonymous_variant ; p.Asn53Asn; LOW	synonymous_codon	Average:80.453; most accessible tissue: Minghui63 root, score: 89.526	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1219115124	G	A	0.0	0.02	0.02	0.01	0.03	0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1219115124	NA	4.30E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	NA	9.08E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	NA	2.97E-12	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	1.15E-09	6.13E-55	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	5.38E-07	4.17E-12	mr1458	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	NA	1.56E-07	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	NA	1.83E-19	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	1.17E-07	1.09E-56	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	8.74E-06	2.15E-11	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219115124	NA	2.06E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251