Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1219106260:

Variant ID: vg1219106260 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 19106260
Reference Allele: CAlternative Allele: CACTGTACTACT,CTACCACTGTACTACT,T,CTACCACTGCTACT
Primary Allele: CTACCACTGTACTACTSecondary Allele: CACTGTACTACT

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTTCATCAAACCAGCAGCGTAGATAATGGAAACAAAAGGATGCTTAGAATTAATCTACGGAGTATAGTAGGGATTAAGAAGGGGGAGATACTACTAC[C/CACTGTACTACT,CTACCACTGTACTACT,T,CTACCACTGCTACT]
GCTCACTAACTGAAAGTTCTAGCTAGGTTGCTTGCCTAACCATCTGGGACGACATTATTCAGCAACCATGCAATGGCTGCAGGGACCATTTCATCTGAAC

Reverse complement sequence

GTTCAGATGAAATGGTCCCTGCAGCCATTGCATGGTTGCTGAATAATGTCGTCCCAGATGGTTAGGCAAGCAACCTAGCTAGAACTTTCAGTTAGTGAGC[G/AGTAGTACAGTG,AGTAGTACAGTGGTAG,A,AGTAGCAGTGGTAG]
GTAGTAGTATCTCCCCCTTCTTAATCCCTACTATACTCCGTAGATTAATTCTAAGCATCCTTTTGTTTCCATTATCTACGCTGCTGGTTTGATGAAATTC

Allele Frequencies:

Populations Population SizeFrequency of CTACCACTGTACTACT(primary allele) Frequency of CACTGTACTACT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 41.10% 0.51% 0.00% C: 15.47%; T: 0.49%; CTACCACTGCTACT: 0.11%
All Indica  2759 27.00% 66.90% 0.65% 0.00% C: 4.75%; T: 0.58%; CTACCACTGCTACT: 0.11%
All Japonica  1512 61.10% 0.80% 0.13% 0.00% C: 37.57%; T: 0.40%
Aus  269 75.10% 20.80% 1.12% 0.00% C: 2.60%; T: 0.37%
Indica I  595 28.70% 67.90% 1.68% 0.00% T: 1.01%; C: 0.67%
Indica II  465 10.80% 68.80% 0.00% 0.00% C: 19.57%; T: 0.65%; CTACCACTGCTACT: 0.22%
Indica III  913 29.40% 70.00% 0.00% 0.00% C: 0.55%; T: 0.11%
Indica Intermediate  786 32.70% 61.30% 1.02% 0.00% C: 3.94%; T: 0.76%; CTACCACTGCTACT: 0.25%
Temperate Japonica  767 35.10% 0.90% 0.00% 0.00% C: 63.62%; T: 0.39%
Tropical Japonica  504 94.60% 0.60% 0.40% 0.00% C: 3.97%; T: 0.40%
Japonica Intermediate  241 73.90% 0.80% 0.00% 0.00% C: 24.90%; T: 0.41%
VI/Aromatic  96 94.80% 4.20% 0.00% 0.00% C: 1.04%
Intermediate  90 42.20% 27.80% 1.11% 0.00% C: 26.67%; CTACCACTGCTACT: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1219106260 C -> CTACCACTGTACTACT LOC_Os12g31748.2 3_prime_UTR_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> CTACCACTGTACTACT LOC_Os12g31748.1 3_prime_UTR_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> CACTGTACTACT LOC_Os12g31748.2 3_prime_UTR_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> CACTGTACTACT LOC_Os12g31748.1 3_prime_UTR_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> CTACCACTGCTACT LOC_Os12g31748.2 3_prime_UTR_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> CTACCACTGCTACT LOC_Os12g31748.1 3_prime_UTR_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> T LOC_Os12g31748.2 3_prime_UTR_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N
vg1219106260 C -> T LOC_Os12g31748.1 3_prime_UTR_variant ; 106.0bp to feature; MODIFIER silent_mutation Average:70.725; most accessible tissue: Callus, score: 92.588 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1219106260 C CACTG* -0.04 0.07 0.05 0.07 -0.04 -0.09
vg1219106260 C CTACC* 0.12 0.24 0.19 0.22 0.17 0.07
vg1219106260 C T 0.03 0.01 0.01 0.06 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1219106260 NA 2.42E-17 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1219106260 NA 4.93E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 7.94E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 2.60E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 5.27E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 6.39E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 3.59E-07 mr1193 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 8.97E-07 mr1446 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 5.14E-07 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 6.36E-09 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 4.94E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 7.11E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 9.18E-08 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 3.40E-06 7.25E-09 mr1642 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 7.70E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 5.03E-06 mr1704 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 4.12E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 6.77E-06 mr1796 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 1.32E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 8.84E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1219106260 NA 6.34E-07 mr1521_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251