| Variant ID: vg1219030340 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 19030340 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACAAATGTTTCTATAATGTAAATTAAAATATATTACTTCACAAATATAAGCAAATAGAACTAGATCTATAATATAAATATCAAATATCAAATCAATGGTC[T/C]
TTAAACATTCATCTTTTTAATTTATATTTATATTCAATTTGTGATTAGTTTCATGCTTTAATTAAATGAAATATTTATGTCTTATAAAAGGTATATTATG
CATAATATACCTTTTATAAGACATAAATATTTCATTTAATTAAAGCATGAAACTAATCACAAATTGAATATAAATATAAATTAAAAAGATGAATGTTTAA[A/G]
GACCATTGATTTGATATTTGATATTTATATTATAGATCTAGTTCTATTTGCTTATATTTGTGAAGTAATATATTTTAATTTACATTATAGAAACATTTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.10% | 0.40% | 2.67% | 21.84% | NA |
| All Indica | 2759 | 88.40% | 0.00% | 2.72% | 8.84% | NA |
| All Japonica | 1512 | 47.60% | 0.90% | 3.04% | 48.41% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.60% | 0.00% | 6.55% | 22.86% | NA |
| Indica II | 465 | 91.40% | 0.00% | 2.37% | 6.24% | NA |
| Indica III | 913 | 96.70% | 0.00% | 1.10% | 2.19% | NA |
| Indica Intermediate | 786 | 90.60% | 0.00% | 1.91% | 7.51% | NA |
| Temperate Japonica | 767 | 67.70% | 0.10% | 0.91% | 31.29% | NA |
| Tropical Japonica | 504 | 13.70% | 2.40% | 5.95% | 77.98% | NA |
| Japonica Intermediate | 241 | 54.80% | 0.40% | 3.73% | 41.08% | NA |
| VI/Aromatic | 96 | 49.00% | 4.20% | 3.12% | 43.75% | NA |
| Intermediate | 90 | 82.20% | 0.00% | 2.22% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1219030340 | T -> C | LOC_Os12g31600-LOC_Os12g31610 | intergenic_region ; MODIFIER | silent_mutation | Average:11.216; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| vg1219030340 | T -> DEL | N | N | silent_mutation | Average:11.216; most accessible tissue: Minghui63 root, score: 17.665 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1219030340 | NA | 3.72E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219030340 | 4.61E-06 | 1.82E-09 | mr1871 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219030340 | 6.88E-06 | 1.50E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1219030340 | NA | 2.27E-08 | mr1871_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |