\
| Variant ID: vg1218957710 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 18957710 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 72. )
TTCTATTATCTGGGCTAATTACTAAGTGGGCCTACTACATAGAATTCGGTCTAGGAAAGTGTTTTCCTTTTTTAAAATTGTTATTCTTTTCTTTCCTATT[G/C]
TAAAGTCCAAGAAATACACGGAATAACCAATTTTTTGGAAAATTTATATCCAAATAGGTTCTATGAATATCACTATTTAGAGTAAATTTTAGAAAACTGC
GCAGTTTTCTAAAATTTACTCTAAATAGTGATATTCATAGAACCTATTTGGATATAAATTTTCCAAAAAATTGGTTATTCCGTGTATTTCTTGGACTTTA[C/G]
AATAGGAAAGAAAAGAATAACAATTTTAAAAAAGGAAAACACTTTCCTAGACCGAATTCTATGTAGTAGGCCCACTTAGTAATTAGCCCAGATAATAGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.70% | 40.40% | 5.78% | 10.22% | NA |
| All Indica | 2759 | 62.80% | 12.10% | 8.95% | 16.13% | NA |
| All Japonica | 1512 | 6.20% | 93.20% | 0.33% | 0.33% | NA |
| Aus | 269 | 65.40% | 17.10% | 7.06% | 10.41% | NA |
| Indica I | 595 | 65.70% | 6.20% | 15.13% | 12.94% | NA |
| Indica II | 465 | 55.30% | 21.90% | 9.03% | 13.76% | NA |
| Indica III | 913 | 64.60% | 8.30% | 6.90% | 20.15% | NA |
| Indica Intermediate | 786 | 63.00% | 15.10% | 6.62% | 15.27% | NA |
| Temperate Japonica | 767 | 1.20% | 98.30% | 0.26% | 0.26% | NA |
| Tropical Japonica | 504 | 4.60% | 94.60% | 0.20% | 0.60% | NA |
| Japonica Intermediate | 241 | 25.30% | 73.90% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 31.20% | 65.60% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 34.40% | 61.10% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1218957710 | G -> C | LOC_Os12g31510.1 | downstream_gene_variant ; 1938.0bp to feature; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Callus, score: 49.43 | N | N | N | N |
| vg1218957710 | G -> C | LOC_Os12g31520.1 | downstream_gene_variant ; 1677.0bp to feature; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Callus, score: 49.43 | N | N | N | N |
| vg1218957710 | G -> C | LOC_Os12g31510-LOC_Os12g31520 | intergenic_region ; MODIFIER | silent_mutation | Average:24.184; most accessible tissue: Callus, score: 49.43 | N | N | N | N |
| vg1218957710 | G -> DEL | N | N | silent_mutation | Average:24.184; most accessible tissue: Callus, score: 49.43 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1218957710 | 4.32E-06 | 4.69E-11 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218957710 | NA | 5.73E-07 | mr1457_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218957710 | 1.24E-06 | 3.60E-11 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1218957710 | 3.06E-06 | 7.82E-06 | mr1563_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |