\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218957710:

Variant ID: vg1218957710 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18957710
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, C: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTATTATCTGGGCTAATTACTAAGTGGGCCTACTACATAGAATTCGGTCTAGGAAAGTGTTTTCCTTTTTTAAAATTGTTATTCTTTTCTTTCCTATT[G/C]
TAAAGTCCAAGAAATACACGGAATAACCAATTTTTTGGAAAATTTATATCCAAATAGGTTCTATGAATATCACTATTTAGAGTAAATTTTAGAAAACTGC

Reverse complement sequence

GCAGTTTTCTAAAATTTACTCTAAATAGTGATATTCATAGAACCTATTTGGATATAAATTTTCCAAAAAATTGGTTATTCCGTGTATTTCTTGGACTTTA[C/G]
AATAGGAAAGAAAAGAATAACAATTTTAAAAAAGGAAAACACTTTCCTAGACCGAATTCTATGTAGTAGGCCCACTTAGTAATTAGCCCAGATAATAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.70% 40.40% 5.78% 10.22% NA
All Indica  2759 62.80% 12.10% 8.95% 16.13% NA
All Japonica  1512 6.20% 93.20% 0.33% 0.33% NA
Aus  269 65.40% 17.10% 7.06% 10.41% NA
Indica I  595 65.70% 6.20% 15.13% 12.94% NA
Indica II  465 55.30% 21.90% 9.03% 13.76% NA
Indica III  913 64.60% 8.30% 6.90% 20.15% NA
Indica Intermediate  786 63.00% 15.10% 6.62% 15.27% NA
Temperate Japonica  767 1.20% 98.30% 0.26% 0.26% NA
Tropical Japonica  504 4.60% 94.60% 0.20% 0.60% NA
Japonica Intermediate  241 25.30% 73.90% 0.83% 0.00% NA
VI/Aromatic  96 31.20% 65.60% 1.04% 2.08% NA
Intermediate  90 34.40% 61.10% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218957710 G -> C LOC_Os12g31510.1 downstream_gene_variant ; 1938.0bp to feature; MODIFIER silent_mutation Average:24.184; most accessible tissue: Callus, score: 49.43 N N N N
vg1218957710 G -> C LOC_Os12g31520.1 downstream_gene_variant ; 1677.0bp to feature; MODIFIER silent_mutation Average:24.184; most accessible tissue: Callus, score: 49.43 N N N N
vg1218957710 G -> C LOC_Os12g31510-LOC_Os12g31520 intergenic_region ; MODIFIER silent_mutation Average:24.184; most accessible tissue: Callus, score: 49.43 N N N N
vg1218957710 G -> DEL N N silent_mutation Average:24.184; most accessible tissue: Callus, score: 49.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218957710 4.32E-06 4.69E-11 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957710 NA 5.73E-07 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957710 1.24E-06 3.60E-11 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218957710 3.06E-06 7.82E-06 mr1563_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251