\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218938385:

Variant ID: vg1218938385 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18938385
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTCATTTTTCTGCCCTGTTTAGCTAAGTTCGAGATTTTAGATTTGAATTTTGAGCGTGAAACTTGTTTGAACTGTTGTCTTAAAGATATGAGAGTTTC[T/G]
AATGAAAGATATGAGTTTGTTCATTTTTCTGCCCTGTTTAGCGGAGTTGGAGTTTTTAAATTTAAATTCGAAAGATAGAGAATTTGTTCAACGAAAGATA

Reverse complement sequence

TATCTTTCGTTGAACAAATTCTCTATCTTTCGAATTTAAATTTAAAAACTCCAACTCCGCTAAACAGGGCAGAAAAATGAACAAACTCATATCTTTCATT[A/C]
GAAACTCTCATATCTTTAAGACAACAGTTCAAACAAGTTTCACGCTCAAAATTCAAATCTAAAATCTCGAACTTAGCTAAACAGGGCAGAAAAATGAACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 33.90% 0.89% 1.76% NA
All Indica  2759 94.20% 3.30% 1.16% 1.27% NA
All Japonica  1512 7.40% 92.30% 0.26% 0.00% NA
Aus  269 90.70% 0.40% 0.37% 8.55% NA
Indica I  595 95.60% 3.00% 1.18% 0.17% NA
Indica II  465 97.00% 2.40% 0.22% 0.43% NA
Indica III  913 93.40% 2.40% 1.53% 2.63% NA
Indica Intermediate  786 92.50% 5.20% 1.27% 1.02% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 5.60% 93.80% 0.60% 0.00% NA
Japonica Intermediate  241 28.20% 71.40% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 63.50% 3.12% 19.79% NA
Intermediate  90 32.20% 58.90% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218938385 T -> DEL N N silent_mutation Average:34.922; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg1218938385 T -> G LOC_Os12g31480.1 downstream_gene_variant ; 2259.0bp to feature; MODIFIER silent_mutation Average:34.922; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg1218938385 T -> G LOC_Os12g31485.1 downstream_gene_variant ; 1461.0bp to feature; MODIFIER silent_mutation Average:34.922; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg1218938385 T -> G LOC_Os12g31490.1 downstream_gene_variant ; 329.0bp to feature; MODIFIER silent_mutation Average:34.922; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N
vg1218938385 T -> G LOC_Os12g31485-LOC_Os12g31490 intergenic_region ; MODIFIER silent_mutation Average:34.922; most accessible tissue: Zhenshan97 flower, score: 51.467 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218938385 NA 9.05E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 2.13E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 6.71E-15 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 6.09E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 6.78E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.14E-74 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.61E-49 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.83E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.91E-21 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 7.31E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 2.68E-21 mr1254 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.02E-14 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 2.29E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.39E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 9.74E-27 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 2.80E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 7.25E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.93E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.19E-40 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 4.93E-07 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 4.57E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.15E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 5.64E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 2.90E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.18E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.19E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.01E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 4.19E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.09E-36 mr1944 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 8.06E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 1.08E-101 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 2.19E-16 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 4.43E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 4.82E-25 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.94E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 9.35E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 5.82E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.80E-20 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 4.05E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218938385 NA 3.68E-42 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251