Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218931252:

Variant ID: vg1218931252 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 18931252
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGTATGGACTCGGCAACAAAGTCTCGATCTACGGCGACACATACAGCTTCGGAGTACTACTGCTGGAAATCTTCACAGGAAAAAGGCCAACGGATGCT[G/C]
ATTTCGCGCAAGATCTCAGCCTTCACAGGTATGTGCAGATCGCGCTGAGAGATCACCAAGTCGCCAGCGTGATAGACGAACAGCTACTACTGTCAGTACA

Reverse complement sequence

TGTACTGACAGTAGTAGCTGTTCGTCTATCACGCTGGCGACTTGGTGATCTCTCAGCGCGATCTGCACATACCTGTGAAGGCTGAGATCTTGCGCGAAAT[C/G]
AGCATCCGTTGGCCTTTTTCCTGTGAAGATTTCCAGCAGTAGTACTCCGAAGCTGTATGTGTCGCCGTAGATCGAGACTTTGTTGCCGAGTCCATACTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	1.10%	9.35%	2.90%	NA
All Indica	2759	80.00%	1.60%	14.06%	4.31%	NA
All Japonica	1512	99.70%	0.00%	0.26%	0.07%	NA
Aus	269	76.20%	1.90%	15.99%	5.95%	NA
Indica I	595	69.20%	3.00%	25.21%	2.52%	NA
Indica II	465	82.40%	1.30%	12.47%	3.87%	NA
Indica III	913	85.30%	1.00%	7.89%	5.81%	NA
Indica Intermediate	786	80.50%	1.50%	13.74%	4.20%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.00%	0.83%	0.41%	NA
VI/Aromatic	96	96.90%	0.00%	2.08%	1.04%	NA
Intermediate	90	92.20%	2.20%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1218931252	G -> C	LOC_Os12g31470.1	missense_variant ; p.Asp2179His; MODERATE	nonsynonymous_codon ; D2179H	Average:68.726; most accessible tissue: Callus, score: 87.139	unknown	unknown	TOLERATED	0.12
vg1218931252	G -> DEL	LOC_Os12g31470.1	N	frameshift_variant	Average:68.726; most accessible tissue: Callus, score: 87.139	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1218931252	NA	7.50E-07	mr1144	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	3.10E-08	7.58E-19	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	2.74E-06	2.02E-10	mr1457	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	8.58E-15	1.28E-66	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	3.49E-11	2.40E-23	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	4.03E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	4.12E-07	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	9.93E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	4.32E-11	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	2.45E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	1.74E-07	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	7.57E-08	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	2.32E-24	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	2.82E-08	mr1457_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	1.91E-08	3.97E-63	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	1.28E-19	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	5.39E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	5.54E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218931252	NA	7.51E-09	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251