\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1218909367:

Variant ID: vg1218909367 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 18909367
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.51, A: 0.50, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGGGTGGCGCCGCCGCGGATGGTCTAGGCGGCTGGTTGGTGTGGCGGGGCGGGGCGGGCCGCGTGATTTGGTAGGGTTCGTCCATGTCGCTCGTTGGG[A/G]
GAAGGCGGTGGAGCCTAGGGTTTGCGTGCGTCGCACATAGATCCAGATGAAAATAATTGCACTAGAGGCTTCCTCGCGTTGGAGAATTTTTGGGGTTTCA

Reverse complement sequence

TGAAACCCCAAAAATTCTCCAACGCGAGGAAGCCTCTAGTGCAATTATTTTCATCTGGATCTATGTGCGACGCACGCAAACCCTAGGCTCCACCGCCTTC[T/C]
CCCAACGAGCGACATGGACGAACCCTACCAAATCACGCGGCCCGCCCCGCCCCGCCACACCAACCAGCCGCCTAGACCATCCGCGGCGGCGCCACCCACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 35.80% 0.04% 0.00% NA
All Indica  2759 95.10% 4.90% 0.07% 0.00% NA
All Japonica  1512 7.50% 92.50% 0.00% 0.00% NA
Aus  269 91.10% 8.90% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 96.10% 3.70% 0.22% 0.00% NA
Indica III  913 95.70% 4.20% 0.11% 0.00% NA
Indica Intermediate  786 93.00% 7.00% 0.00% 0.00% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 5.80% 94.20% 0.00% 0.00% NA
Japonica Intermediate  241 28.20% 71.80% 0.00% 0.00% NA
VI/Aromatic  96 20.80% 79.20% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1218909367 A -> G LOC_Os12g31430.1 downstream_gene_variant ; 4702.0bp to feature; MODIFIER silent_mutation Average:90.235; most accessible tissue: Minghui63 flag leaf, score: 97.612 N N N N
vg1218909367 A -> G LOC_Os12g31450.1 downstream_gene_variant ; 3887.0bp to feature; MODIFIER silent_mutation Average:90.235; most accessible tissue: Minghui63 flag leaf, score: 97.612 N N N N
vg1218909367 A -> G LOC_Os12g31440.1 intron_variant ; MODIFIER silent_mutation Average:90.235; most accessible tissue: Minghui63 flag leaf, score: 97.612 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1218909367 A G 0.01 0.01 0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1218909367 NA 6.09E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 7.31E-08 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 9.06E-15 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 5.64E-14 mr1376 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 5.64E-14 mr1431 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 1.77E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 1.16E-06 NA mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 3.02E-09 7.16E-10 mr1458 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 1.35E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 6.78E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 8.06E-06 mr1944 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 3.94E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 1.82E-08 2.03E-12 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1218909367 NA 2.09E-18 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251